Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SGCA-sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein) Gene
PTXBC025702
New product
Data sheet of SGCA-sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SGCA-sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025702 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SGCA |
| Origin species: | Human |
| Product name: | SGCA-sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein) Gene |
| Size: | 2ug |
| Accessions: | BC025702 |
| Gene id: | 6442 |
| Gene description: | sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein) |
| Synonyms: | 50DAG; ADL; DAG2; DMDA2; LGMD2D; SCARMD1; adhalin; alpha-sarcoglycan; 50 kDa dystrophin-associated glycoprotein; 50kD DAG; alpha-SG; dystroglycan-2; limb girdle muscular dystrophy 2D; sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein); sarcoglycan alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgagacactcttctggactcctctcctcgtggttctcctggcagggctgggggacaccgaggcccagcagaccacgctacacccacttgtgggccgtgtctttgtgcacaccttggaccatgagacgtttctgagccttcctgagcatgtcgctgtcccacccgctgtccacatcacctaccacgcccacctccagggacacccagacctgccccggtggctccgctacacccagcgcagcccccaccaccctggcttcctctacggctctgccaccccagaagatcgtgggctccaggtcattgaggtcacagcctacaatcgggacagctttgataccactcggcagaggctggtgctggagattggggacccagaaggccccctgctgccataccaagccgagttcctggtgcgcagccacgatgcggaggaggtgctgccctcaacacctgccagccgcttcctctcagccttggggggactctgggagcccggagagcttcagctgctcaacgtcacctctgccttggaccgtgggggccgtgtcccccttcccattgagggccgaaaagaaggggtatacattaaggtgggttctgcctcacctttttctacttgcctgaagatggtggcatcccccgatagccacgcccgctgtgcccagggccagcctccacttctgtcttgctacgacaccttggcaccccacttccgcgttgactggtgcaatgtgaccctggtggataagtcagtgccggagcctgcagatgaggtgcccaccccaggtgatgggatcctggagcatgacccgttcttctgcccacccactgaggccccagaccgtgacttcttggtggatgctctggtcaccctcctggtgcccctgctggtggccctgcttctcaccttgctgctggcctatgtcatgtgctgccggcgggagggaaggctgaagagagacctggctacctccgacatccagatggtccaccactgcaccatccacgggaacacagaggagctgcggcagatggcggccagccgcgaggtgccccggccactctccaccctgcccatgttcaatgtgcacacaggtgagcggctgcctccccgcgtggacagcgcccaggtgcccctcattctggaccagcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serpin peptidase inhibitor, clade B (ovalbumin), member 4 - proline-serine-threonine phosphatase interacting protein 1 - SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae) - potassium inwardly-rectifying channel, subfamily J, member 3 |