PVRIG-poliovirus receptor related immunoglobulin domain containing Gene View larger

PVRIG-poliovirus receptor related immunoglobulin domain containing Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PVRIG-poliovirus receptor related immunoglobulin domain containing Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PVRIG-poliovirus receptor related immunoglobulin domain containing Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001129
Product type: DNA & cDNA
Ncbi symbol: PVRIG
Origin species: Human
Product name: PVRIG-poliovirus receptor related immunoglobulin domain containing Gene
Size: 2ug
Accessions: BC001129
Gene id: 79037
Gene description: poliovirus receptor related immunoglobulin domain containing
Synonyms: transmembrane protein PVRIG; C7orf15; CD112R; CD112 receptor; poliovirus receptor-related immunoglobulin domain-containing protein; poliovirus receptor related immunoglobulin domain containing
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagaacagaggcacaggtgccggccctgcagcccccagaacctggactggagggggccatggggcaccggaccctggtcctgccctgggtgctgctgaccttgtgtgtcactgcggggaccccggaggtgtgggttcaagttcggatggaggccaccgagctctcgtccttcaccatccgttgtgggttcctggggtctggctccatctccctggtgactgtgagctgggggggccccgacggtgctggggggaccacgctggctgtgttgcacccagaacgtggcatccggcaatgggcccctgctcgccaggcccgctgggaaacccagagcagcatctctctcatcctggaaggctctggggccagcagcccctgcgccaacaccaccttctgctgcaagtttgcgtccttccctgagggctcctgggaggcctgtgggagcctcccgcccagctcagacccagggctctctgccccgccgactcctgcccccattctgcgggcagacctggccgggatcttgggggtctcaggagtcctcctctttggctgtgtctacctccttcatctgctgcgccgacataagcaccgccctgcccctaggctccagccgtcccgcaccagcccccaggcaccgagagcacgagcatgggcaccaagccaggcctcccaggctgctcttcacgtcccttatgccactatcaacaccagctgccgcccagctactttggacacagctcacccccatggggggccgtcctggtgggcgtcactccccacccacgctgcacaccggccccagggccctgccgcctgggcctccacacccatccctgcacgtggcagctttgtctctgttgagaatggactctacgctcaggcaggggagaggcctcctcacactggtcccggcctcactcttttccctgaccctcgggggcccagggccatggaaggacccttaggagttcgatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein kinase, cAMP-dependent, regulatory, type II, alpha
- protein phosphatase 1, regulatory (inhibitor) subunit 12B
- sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)
- serpin peptidase inhibitor, clade B (ovalbumin), member 4

Buy PVRIG-poliovirus receptor related immunoglobulin domain containing Gene now

Add to cart