SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene View larger

SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018437
Product type: DNA & cDNA
Ncbi symbol: SEC22C
Origin species: Human
Product name: SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene
Size: 2ug
Accessions: BC018437
Gene id: 9117
Gene description: SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
Synonyms: vesicle-trafficking protein SEC22c; SEC22L3; SEC22 vesicle trafficking protein homolog C; SEC22 vesicle trafficking protein-like 3; SEC22 vesicle trafficking protein-like protein C; secretion deficient 22C; SEC22 homolog C, vesicle trafficking protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgtgatcttttttgcctgcgtggtacgggtaagggatggactgcccctctcagcctctactgatttttaccacacccaagattttttggaatggaggagacggctcaagagtttagccttgcgactggcccagtatccaggtcgaggttctgcagaaggttgtgactttagtatacatttttcttctttcggggacgtggcctgcatggctatctgctcctgccagtgtccagcagccatggccttctgcttcctggagaccctgtggtgggaattcacagcttcctatgacactacctgcattggcctagcctccaggccatacgcttttcttgagtttgacagcatcattcagaaagtgaagtggcattttaactatgtaagttcctctcagatggagtgcagcttggaaaaaattcaggaggagctcaagttgcagcctccagcggttctcactctggaggacacagatgtggcaaatggggtgatgaatggtcacacaccgatgcacttggagcctgctcctaatttccgaatggaaccagtgacagccctgggtatcctctccctcattctcaacatcatgtgtgctgccctgaatctcattcgaggagttcaccttgcagaacattctttacaggttgcccatgaggaaattggaaacattctggcttttcttgttcctttcgtagcctgcattttccaggatccaaggagctggttctgctggttggaccaaacctcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin protein ligase E3 component n-recognin 7 (putative)
- SEC22 vesicle trafficking protein homolog A (S. cerevisiae)
- poliovirus receptor related immunoglobulin domain containing
- protein kinase, cAMP-dependent, regulatory, type II, alpha

Buy SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene now

Add to cart