Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene
PTXBC018437
New product
Data sheet of SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018437 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SEC22C |
| Origin species: | Human |
| Product name: | SEC22C-SEC22 vesicle trafficking protein homolog C (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC018437 |
| Gene id: | 9117 |
| Gene description: | SEC22 vesicle trafficking protein homolog C (S. cerevisiae) |
| Synonyms: | vesicle-trafficking protein SEC22c; SEC22L3; SEC22 vesicle trafficking protein homolog C; SEC22 vesicle trafficking protein-like 3; SEC22 vesicle trafficking protein-like protein C; secretion deficient 22C; SEC22 homolog C, vesicle trafficking protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgtgatcttttttgcctgcgtggtacgggtaagggatggactgcccctctcagcctctactgatttttaccacacccaagattttttggaatggaggagacggctcaagagtttagccttgcgactggcccagtatccaggtcgaggttctgcagaaggttgtgactttagtatacatttttcttctttcggggacgtggcctgcatggctatctgctcctgccagtgtccagcagccatggccttctgcttcctggagaccctgtggtgggaattcacagcttcctatgacactacctgcattggcctagcctccaggccatacgcttttcttgagtttgacagcatcattcagaaagtgaagtggcattttaactatgtaagttcctctcagatggagtgcagcttggaaaaaattcaggaggagctcaagttgcagcctccagcggttctcactctggaggacacagatgtggcaaatggggtgatgaatggtcacacaccgatgcacttggagcctgctcctaatttccgaatggaaccagtgacagccctgggtatcctctccctcattctcaacatcatgtgtgctgccctgaatctcattcgaggagttcaccttgcagaacattctttacaggttgcccatgaggaaattggaaacattctggcttttcttgttcctttcgtagcctgcattttccaggatccaaggagctggttctgctggttggaccaaacctcgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin protein ligase E3 component n-recognin 7 (putative) - SEC22 vesicle trafficking protein homolog A (S. cerevisiae) - poliovirus receptor related immunoglobulin domain containing - protein kinase, cAMP-dependent, regulatory, type II, alpha |