MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene View larger

MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene

PTXBC012425

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012425
Product type: DNA & cDNA
Ncbi symbol: MYL6B
Origin species: Human
Product name: MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene
Size: 2ug
Accessions: BC012425
Gene id: 140465
Gene description: myosin, light chain 6B, alkali, smooth muscle and non-muscle
Synonyms: MLC1SA; myosin light chain 6B; myosin alkali light chain 1 slow a; myosin light chain 1 slow a; myosin light chain 1, slow-twitch muscle A isoform; myosin, light chain 6B, alkali, smooth muscle and non-muscle; myosin, light polypeptide 6B, alkali, smooth muscle and non-muscle; smooth muscle and non-muscle myosin alkali light chain 6B; smooth muscle and nonmuscle myosin light chain alkali 6B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctcccaagaaggatgttcccgtgaagaaaccagcagggccctccatctccaaacctgctgctaagccagcagcagcaggggctcctccagccaagaccaaagctgagccagctgtcccccaggcccctcagaaaacccaggagcctccagtcgatctctccaaagtggtgatcgagtttaacaaggaccagctggaggagttcaaggaggccttcgagctgtttgaccgagtgggggatggcaagatcctgtacagccagtgtggggacgtgatgagggccctgggccagaaccccaccaacgccgaggtgctcaaggtcctggggaaccccaagagtgatgagctgaagtcgcggcgtgtggactttgagactttcctgcccatgctccaggcagtggccaagaaccgaggccaaggcacatatgaggactacttggaggggtttcgtgtgtttgacaaggaggggaacggcaaagtcatgggagcagagctcagacatgttctcaccacccttggagagaagatgactgaggaggaggtggagaccgttctggcaggacacgaggacagcaacggctgcatcaactacgaggccttcttgaaacacatcctaagcgtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidic acid phosphatase type 2 domain containing 1B
- eukaryotic translation initiation factor 4E family member 2
- SEC22 vesicle trafficking protein homolog C (S. cerevisiae)
- ubiquitin protein ligase E3 component n-recognin 7 (putative)

Buy MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene now

Add to cart