PTXBC012425
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC012425 |
Product type: | DNA & cDNA |
Ncbi symbol: | MYL6B |
Origin species: | Human |
Product name: | MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene |
Size: | 2ug |
Accessions: | BC012425 |
Gene id: | 140465 |
Gene description: | myosin, light chain 6B, alkali, smooth muscle and non-muscle |
Synonyms: | MLC1SA; myosin light chain 6B; myosin alkali light chain 1 slow a; myosin light chain 1 slow a; myosin light chain 1, slow-twitch muscle A isoform; myosin, light chain 6B, alkali, smooth muscle and non-muscle; myosin, light polypeptide 6B, alkali, smooth muscle and non-muscle; smooth muscle and non-muscle myosin alkali light chain 6B; smooth muscle and nonmuscle myosin light chain alkali 6B |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgcctcccaagaaggatgttcccgtgaagaaaccagcagggccctccatctccaaacctgctgctaagccagcagcagcaggggctcctccagccaagaccaaagctgagccagctgtcccccaggcccctcagaaaacccaggagcctccagtcgatctctccaaagtggtgatcgagtttaacaaggaccagctggaggagttcaaggaggccttcgagctgtttgaccgagtgggggatggcaagatcctgtacagccagtgtggggacgtgatgagggccctgggccagaaccccaccaacgccgaggtgctcaaggtcctggggaaccccaagagtgatgagctgaagtcgcggcgtgtggactttgagactttcctgcccatgctccaggcagtggccaagaaccgaggccaaggcacatatgaggactacttggaggggtttcgtgtgtttgacaaggaggggaacggcaaagtcatgggagcagagctcagacatgttctcaccacccttggagagaagatgactgaggaggaggtggagaccgttctggcaggacacgaggacagcaacggctgcatcaactacgaggccttcttgaaacacatcctaagcgtttga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - phosphatidic acid phosphatase type 2 domain containing 1B - eukaryotic translation initiation factor 4E family member 2 - SEC22 vesicle trafficking protein homolog C (S. cerevisiae) - ubiquitin protein ligase E3 component n-recognin 7 (putative) |