Login to display prices
Login to display prices
PPAPDC1B-phosphatidic acid phosphatase type 2 domain containing 1B Gene View larger

PPAPDC1B-phosphatidic acid phosphatase type 2 domain containing 1B Gene

PTXBC033025

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPAPDC1B-phosphatidic acid phosphatase type 2 domain containing 1B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPAPDC1B-phosphatidic acid phosphatase type 2 domain containing 1B Gene

Proteogenix catalog: PTXBC033025
Ncbi symbol: PPAPDC1B
Product name: PPAPDC1B-phosphatidic acid phosphatase type 2 domain containing 1B Gene
Size: 2ug
Accessions: BC033025
Gene id: 84513
Gene description: phosphatidic acid phosphatase type 2 domain containing 1B
Synonyms: phosphatidate phosphatase PPAPDC1B; PPAPDC1B; DPPL1; phospholipid phosphatase 5; diacylglycerol pyrophosphate like 1; diacylglycerol pyrophosphate phosphatase-like 1; phosphatidic acid phosphatase type 2 domain containing 1B; phosphatidic acid phosphatase type 2 domain-containing protein 1B; testicular secretory protein Li 38
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggctctaccggaacccctacgtggaggcggagtatttccccaccaagccgatgtttgttattgcatttctctctccactgtctctgatcttcctggccaaatttctcaagaaggcagacacaagagacagcagacaagcctgcctggctgccagccttgccctggctctgaatggcgtctttaccaacacaataaaactgatcgtagggaggccacgcccagatttcttctaccgctgcttccctgatgggctagcccattctgacttgatgtgtacaggggataaggacgtggtgaatgagggccgaaagagcttccccagtggacattcttcctttgcatttgctggtctggcctttgcgtccttctacctggcagggaagttacactgcttcacaccacaaggccgtgggaaatcttggaggttctgtgcctttctgtcacctctactttttgcagctgtgattgcactgtcccgcacatgtgactacaagcatcactggcaagatgtactagttggatccatgattggaatgacatttgcctatgtctgctatcggcagtattatcctcctctgactgatgcagaatgccataaaccatttcaagacaaacttgtactttccactgcacagaagcctggggattcttattgttttgatatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: