Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MED30-mediator complex subunit 30 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MED30-mediator complex subunit 30 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008226 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MED30 |
| Origin species: | Human |
| Product name: | MED30-mediator complex subunit 30 Gene |
| Size: | 2ug |
| Accessions: | BC008226 |
| Gene id: | 90390 |
| Gene description: | mediator complex subunit 30 |
| Synonyms: | MED30S; THRAP6; TRAP25; mediator of RNA polymerase II transcription subunit 30; TRAP/Mediator complex component TRAP25; thyroid hormone receptor-associated protein 6; thyroid hormone receptor-associated protein complex 25 kDa component; mediator complex subunit 30 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccacccctccgttggccgcgtcggggatggcgcccgggcccttcgccgggccccaggctcagcaggccgcccgggaagtcaacacggcgtcgctgtgccgcatcgggcaggagacagtgcaggacatcgtgtaccgcaccatggagatcttccagctcctgaggaacatgcagctgccaaatggtgtcacttaccacactggaacatatcaagaccggttaacaaagctacaggataatcttcgccaactttcagttctcttcaggaagctgagattggtatatgacaaatgcaatgaaaactgtggtgggatggatcccattccagtcgagcaacttattccatatgtggaagaagatggctcaaagaatgatgatcgggctggcccacctcgttttgctagtgaagagaggcgagaaattgctgaagtaaataaaaaactcaaacagaagaatcaacagctgaaacaaattatggatcaattacgaaatctcatctgggatataaatgccatgttggcaatgaggaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - methyltransferase like 7B - fibroblast growth factor 18 - fibroblast growth factor 21 - transmembrane protein 217 |