Login to display prices
Login to display prices
MED30-mediator complex subunit 30 Gene View larger

MED30-mediator complex subunit 30 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MED30-mediator complex subunit 30 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MED30-mediator complex subunit 30 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008226
Product type: DNA & cDNA
Ncbi symbol: MED30
Origin species: Human
Product name: MED30-mediator complex subunit 30 Gene
Size: 2ug
Accessions: BC008226
Gene id: 90390
Gene description: mediator complex subunit 30
Synonyms: MED30S; THRAP6; TRAP25; mediator of RNA polymerase II transcription subunit 30; TRAP/Mediator complex component TRAP25; thyroid hormone receptor-associated protein 6; thyroid hormone receptor-associated protein complex 25 kDa component; mediator complex subunit 30
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccacccctccgttggccgcgtcggggatggcgcccgggcccttcgccgggccccaggctcagcaggccgcccgggaagtcaacacggcgtcgctgtgccgcatcgggcaggagacagtgcaggacatcgtgtaccgcaccatggagatcttccagctcctgaggaacatgcagctgccaaatggtgtcacttaccacactggaacatatcaagaccggttaacaaagctacaggataatcttcgccaactttcagttctcttcaggaagctgagattggtatatgacaaatgcaatgaaaactgtggtgggatggatcccattccagtcgagcaacttattccatatgtggaagaagatggctcaaagaatgatgatcgggctggcccacctcgttttgctagtgaagagaggcgagaaattgctgaagtaaataaaaaactcaaacagaagaatcaacagctgaaacaaattatggatcaattacgaaatctcatctgggatataaatgccatgttggcaatgaggaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methyltransferase like 7B
- fibroblast growth factor 18
- fibroblast growth factor 21
- transmembrane protein 217