TMEM217-transmembrane protein 217 Gene View larger

TMEM217-transmembrane protein 217 Gene

PTXBC026012

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM217-transmembrane protein 217 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM217-transmembrane protein 217 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026012
Product type: DNA & cDNA
Ncbi symbol: TMEM217
Origin species: Human
Product name: TMEM217-transmembrane protein 217 Gene
Size: 2ug
Accessions: BC026012
Gene id: 221468
Gene description: transmembrane protein 217
Synonyms: C6orf128; dJ355M6.2; transmembrane protein 217
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaacagcagcagtggtgtgggatgactgccaaaatgggcaccgtgttgtcaggggtcttcaccatcatggccgtagacatgtatctcatctttgaacagaagcacctagggaatggcagttgcactgagatcacaccaaagtacaggggtgcaagtaacatcataaataacttcatcatctgctggagttttaaaatcgtcctcttcctgtctttcatcaccatcctcatcagctgcttcctcctgtactcagtgtatgcccagatcttcaggggcctggtcatctacattgtctggatttttttctatgaaactgcaaacgtcgtaatacaaatcctcaccaacaatgactttgacattaaagaggtcagaatcatgcgctggtttggcttggtgtctcgtacagtcatgcactgtttctggatgttctttgtcatcaactatgcccacataacctacaaaaaccggagccagggcaatataatttcctacaagagacgaatttctacagcggagattctccacagcagaaataaaagattatcaatttcgagtgggttcagtggctcacacctggaatcccagtactttgagaggcagaggaggtgctctggtaaaacaagtataaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 204
- PQ loop repeat containing 2
- transmembrane protein 39B
- SERTA domain containing 1

Buy TMEM217-transmembrane protein 217 Gene now

Add to cart