PTXBC002670
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002670 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SERTAD1 |
| Origin species: | Human |
| Product name: | SERTAD1-SERTA domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC002670 |
| Gene id: | 29950 |
| Gene description: | SERTA domain containing 1 |
| Synonyms: | SEI1; TRIP-Br1; SERTA domain-containing protein 1; CDK4-binding protein p34SEI; CDK4-binding protein p34SEI1; SEI-1; transcriptional regulator interacting with the PHD-bromodomain 1; SERTA domain containing 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgagcaagggtctgaagcggaaacgggaggaggaggaggagaaggaacctctggcagtcgactcctggtggctagatcctggccacacagcggtggcacaggcacccccggccgtggcctctagctccctctttgacctctcagtgctcaagctccaccacagcctgcagcagagtgagccggacctgcggcacctggtgctggtcgtgaacactctgcggcgcatccaggcgtccatggcacccgcggctgccctgccacctgtgcctagcccacctgcagcccccagtgtggctgacaacttactggcaagctcggacgctgccctttcagcctccatggccagcctcctggaggacctcagccacattgagggcctgagtcaggctccccaacccttggcagacgaggggccaccaggccgtagcatcgggggagcagcgcccagcctgggtgccttggacctgctgggcccagccactggctgtctactggacgatgggcttgagggcctgtttgaggatattgacacctctatgtatgacaatgaactttgggcaccagcctctgagggcctcaaaccaggccctgaggatgggccgggcaaggaggaagctccggagctggacgaggccgaattggactacctcatggatgtgctggtgggcacacaggcactggagcgaccgccggggccagggcgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 174 - MAF1 homolog (S. cerevisiae) - transmembrane protein 55A - transmembrane protein 101 |