Login to display prices
Login to display prices
MAF1-MAF1 homolog (S. cerevisiae) Gene View larger

MAF1-MAF1 homolog (S. cerevisiae) Gene

PTXBC031273

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAF1-MAF1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAF1-MAF1 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC031273
Ncbi symbol: MAF1
Product name: MAF1-MAF1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC031273
Gene id: 84232
Gene description: MAF1 homolog (S. cerevisiae)
Synonyms: MAF1 homolog, negative regulator of RNA polymerase III; homolog of yeast MAF1; MAF1 negative regulator of RNA polymerase III; repressor of RNA polymerase III transcription MAF1 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctattggagaactcaagctttgaagccatcaactcacagctgactgtggagaccggagatgcccacatcattggcaggattgagagctactcatgtaagatggcaggagacgacaaacacatgttcaagcagttctgccaggagggccagccccacgtgctggaggcactttctccaccccagacttcaggactgagccccagcagactcagcaaaagccaaggcggtgaggaggagggccccctcagtgacaagtgcagccgcaagaccctcttctacctgattgccacgctcaatgagtccttcaggcctgactatgacttcagcacagcccgcagccatgagttcagccgggagcccagccttagctgggtggtgaatgcagtcaactgcagtctgttctcagctgtgcgggaggacttcaaggatctgaaaccacagctgtggaacgcggtggacgaggagatctgcctggctgaatgtgacatctacagctataacccagacttggactcagatcccttcggggaggatggtagcctctggtccttcaactacttcttctacaacaagcggctcaagcgaatcgtcttctttagctgccgttccatcagtggctccacctacacaccctcagaggcaggcaacgagctggacatggagctgggggaggaggaggtggaggaagaaagcagaagcaggggcagtggggccgaggagaccagcaccatggaggaggacagggtcccagtgatctgtatttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: