Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of UNC50-unc-50 homolog (C. elegans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UNC50-unc-50 homolog (C. elegans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017019 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UNC50 |
| Origin species: | Human |
| Product name: | UNC50-unc-50 homolog (C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC017019 |
| Gene id: | 25972 |
| Gene description: | unc-50 homolog (C. elegans) |
| Synonyms: | GMH1; HSD23; PDLs22; URP; protein unc-50 homolog; geal-6 membrane-associated high-copy suppressor 1; periodontal ligament-specific protein 22; protein GMH1 homolog; unc-50 related; unc-50-like protein; uncoordinated-like protein; unc-50 inner nuclear membrane RNA binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttaccgagtacttcagtgaattccttagtgcaggggaacggagtcttgaattccagggatgcggcaagacacacagccggagcgaaacgctacaaatatctgagaaggcttttccgctttcggcaaatggactttgaatttgctgcctggcagatgctctacctgttcacatccccacagagagtttacagaaattttcattatcgaaaacagacgaaggaccagtgggccagagatgaccctgctttcttggtcctgttaagtatctggctctgtgtgtccactataggatttggctttgtgctggacatgggattctttgagacaataaagcttctcctttgggttgtactcatagattgtgtaggcgttggtcttctgatagcaactttaatgtggttcatctctaacaagtatttagtgaaacgacagagcagagactatgatgtggaatggggctatgcttttgatgtgcatctcaatgctttttatccactcctggtcattttgcattttatccagctttttttcatcaaccatgttatcctgacagacacatttattggatatttagttggaaataccttatggttggttgcagttggctattatatctatgtaactttcctgggatacagtgcattgccatttttgaaaaatacagtaattcttctgtatccatttgcacctctgattctgctctacgggctttccctggcactgggatggaacttcacccatactctctgttctttctataagtacagagtgaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 187 - 5'-nucleotidase, ecto (CD73) - transmembrane protein 41A - GLI pathogenesis-related 1 |