Login to display prices
Login to display prices
TMEM187-transmembrane protein 187 Gene View larger

TMEM187-transmembrane protein 187 Gene

PTXBC008203

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM187-transmembrane protein 187 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM187-transmembrane protein 187 Gene

Proteogenix catalog: PTXBC008203
Ncbi symbol: TMEM187
Product name: TMEM187-transmembrane protein 187 Gene
Size: 2ug
Accessions: BC008203
Gene id: 8269
Gene description: transmembrane protein 187
Synonyms: CXorf12; DXS9878E; ITBA1; transmembrane protein 187
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatccagagtgggggcaggccttcgtgcacgtggccgtggccggtggcctctgtgccgtggctgtgttcacgggcattttcgacagtgtttccgtgcaagtgggctatgagcactacgccgaggcgcccgtggccggcctccctgccttcctggccatgccgttcaactcactcgtgaacatggcctacacgctgctggggctgtcgtggctgcacaggggcggcgcgatggggctgggtccccgctacctgaaggacgtgttcgcagccatggccctgctctatggccccgtgcagtggctgcgcctgtggacgcagtggcgccgtgccgcggtgctggaccagtggctcacactgcccatctttgcatggcccgtggcctggtgcctctacctagaccgcggctggcggccctggctgttcctctctcttgagtgcgtctccctggccagttatggcctcgctctgctgcatccccagggcttcgaggtcgcactgggtgctcacgtggtggccgctgtggggcaggcgctgcgcacccacaggcactatggcagcaccacctcggctacctacttagctttgggggtgctctcttgcctgggctttgtggtcctcaagctgtgtgaccatcagctcgcacggtggcgtctcttccagtgcctcacaggccacttctggtccaaggtctgtgacgtgctccagttccactttgcgtttttgtttctgacgcatttcaacactcacccaagattccatccctctggcgggaagacgcgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: