TMEM187-transmembrane protein 187 Gene View larger

TMEM187-transmembrane protein 187 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM187-transmembrane protein 187 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM187-transmembrane protein 187 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008203
Product type: DNA & cDNA
Ncbi symbol: TMEM187
Origin species: Human
Product name: TMEM187-transmembrane protein 187 Gene
Size: 2ug
Accessions: BC008203
Gene id: 8269
Gene description: transmembrane protein 187
Synonyms: CXorf12; DXS9878E; ITBA1; transmembrane protein 187
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatccagagtgggggcaggccttcgtgcacgtggccgtggccggtggcctctgtgccgtggctgtgttcacgggcattttcgacagtgtttccgtgcaagtgggctatgagcactacgccgaggcgcccgtggccggcctccctgccttcctggccatgccgttcaactcactcgtgaacatggcctacacgctgctggggctgtcgtggctgcacaggggcggcgcgatggggctgggtccccgctacctgaaggacgtgttcgcagccatggccctgctctatggccccgtgcagtggctgcgcctgtggacgcagtggcgccgtgccgcggtgctggaccagtggctcacactgcccatctttgcatggcccgtggcctggtgcctctacctagaccgcggctggcggccctggctgttcctctctcttgagtgcgtctccctggccagttatggcctcgctctgctgcatccccagggcttcgaggtcgcactgggtgctcacgtggtggccgctgtggggcaggcgctgcgcacccacaggcactatggcagcaccacctcggctacctacttagctttgggggtgctctcttgcctgggctttgtggtcctcaagctgtgtgaccatcagctcgcacggtggcgtctcttccagtgcctcacaggccacttctggtccaaggtctgtgacgtgctccagttccactttgcgtttttgtttctgacgcatttcaacactcacccaagattccatccctctggcgggaagacgcgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 5'-nucleotidase, ecto (CD73)
- transmembrane protein 41A
- GLI pathogenesis-related 1
- EGF-like-domain, multiple 7

Buy TMEM187-transmembrane protein 187 Gene now

Add to cart