Login to display prices
Login to display prices
TMEM55A-transmembrane protein 55A Gene View larger

TMEM55A-transmembrane protein 55A Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM55A-transmembrane protein 55A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM55A-transmembrane protein 55A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033892
Product type: DNA & cDNA
Ncbi symbol: TMEM55A
Origin species: Human
Product name: TMEM55A-transmembrane protein 55A Gene
Size: 2ug
Accessions: BC033892
Gene id: 55529
Gene description: transmembrane protein 55A
Synonyms: type 2 phosphatidylinositol 4,5-bisphosphate 4-phosphatase; PtdIns-4,5-P(2) 4-phosphatase type II; ptdIns-4,5-P2 4-Ptase II; type 2 PtdIns-4,5-P2 4-Ptase; type II phosphatidylinositol 4,5-bisphosphate 4-phosphatase; transmembrane protein 55A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgctgatggggtggacgaacgctcgcctctgctgtcagcatcccactccggaaatgtcactcccaccgccccaccgtacttgcaagaaagcagccccagagcggagctcccacctccatatacagccattgccagtccagacgccagtggtattccagtaataaactgccgtgtgtgccaatcactaatcaatttggatggcaagcttcaccagcatgtggttaagtgcacagtttgcaatgaagctacgccaatcaaaaaccccccaacaggcaagaaatatgttagatgcccttgtaattgtcttctcatttgtaaggacacatctcggcgaataggatgcccaagacccaactgtagacggataattaaccttggcccagtaatgcttatttctgaagaacaaccagctcagcctgcattgccaatccaaccagaaggtacaagggtcgtgtgtgggcactgtggaaacacattcctgtggatggaactgaggttcaacactctggcaaaatgcccacactgcaaaaaaatctcctcagtgggtagtgcacttccacgaagacgctgctgtgcatatattaccattggaatgatatgtattttcattggagttgggttaactgttggcaccccagattttgcaaggcgatttcgagcaacctatgtttcttgggcaattgcttatctcctaggattgatctgccttatccgagcttgttattggggagccataagagtcagttatccagaacacagttttgcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 101
- unc-50 homolog (C. elegans)
- transmembrane protein 187
- 5'-nucleotidase, ecto (CD73)