TMEM101-transmembrane protein 101 Gene View larger

TMEM101-transmembrane protein 101 Gene

PTXBC007438

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM101-transmembrane protein 101 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM101-transmembrane protein 101 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007438
Product type: DNA & cDNA
Ncbi symbol: TMEM101
Origin species: Human
Product name: TMEM101-transmembrane protein 101 Gene
Size: 2ug
Accessions: BC007438
Gene id: 84336
Gene description: transmembrane protein 101
Synonyms: transmembrane protein 101
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtcgaagataggttcgagacggtggatgttgcagctgatcatgcagttgggttcggtgctgctcacacgctgccccttttggggctgcttcagccagctcatgctgtacgctgagagggctgaggcacgccggaagcccgacatcccagtgccttacctgtatttcgacatgggggcagccgtgctgtgcgctagtttcatgtcctttggcgtgaagcggcgctggttcgcgctgggggccgcactccaattggccattagcacctacgccgcctacatcgggggctacgtccactacggggactggctgaaggtccgtatgtactcgcgcacagttgccatcatcggcggctttcttgtgttggccagcggtgctggggagctgtaccgccggaaacctcgcagccgctccctgcagtccaccggccaggtgttcctgggtatctacctcatctgtgtggcctactcactgcagcacagcaaggaggaccggctggcgtatctgaaccatctcccaggaggggagctgatgatccagctgttcttcgtgctgtatggcatcctggccctggcctttctgtcaggctactacgtgaccctcgctgcccagatcctggctgtactgctgccccctgtcatgctgctcattgatggcaatgttgcttactggcacaacacgcggcgtgttgagttctggaaccagatgaagctccttggagagagtgtgggcatcttcggaactgctgtcatcctggccactgatggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - unc-50 homolog (C. elegans)
- transmembrane protein 187
- 5'-nucleotidase, ecto (CD73)
- transmembrane protein 41A

Buy TMEM101-transmembrane protein 101 Gene now

Add to cart