Cart 21 Product Products 5 291,27 € (empty)
-
-
-
1 x ASPRV1-asp...113,40 € -
-
1 x LOC730394-...121,50 € -
-
-
-
-
1 x RNF141-rin...113,40 € -
1 x CCDC106-co...121,50 € -
-
-
-
1 x NME1-non-m...113,40 € -
1 x MBTPS2-mem...121,50 € -
1 x ZCCHC7-zin...113,40 € -
-
-
1 x WBSCR22-Wi...121,50 € -
No products
To be determined Shipping
5 291,27 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 21 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 291,27 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 291,27 €
Data sheet of TMEM39B-transmembrane protein 39B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM39B-transmembrane protein 39B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004364 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM39B |
| Origin species: | Human |
| Product name: | TMEM39B-transmembrane protein 39B Gene |
| Size: | 2ug |
| Accessions: | BC004364 |
| Gene id: | 55116 |
| Gene description: | transmembrane protein 39B |
| Synonyms: | transmembrane protein 39B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccacccatgcctgctgcctgtcacccagcctcatccgcagtgaggtggagttcctcaagatggacttcaactggcgcatgaaggaagtgctcgtcagctccatgctgagcgcctactatgtggcctttgtgcctgtctggttcgtgaagaacacacattactatgacaagcgctggtcctgtgaactcttcctgctggtgtccatcagcacctccgtgatcctcatgcagcacctgctgcctgccagctactgtgacctgctgcacaaggccgccgcccatctgggctgttggcagaaggtggacccagcgctgtgctccaacgtgctgcagcacccgtggactgaagaatgcatgtggccgcagggcgtgctggtgaagcacagcaagaacgtctacaaagccgtaggccactacaacgtggctatcccctctgacgtctcccacttccgcttccatttctttttcagcaaacccctgcggatcctcaacatcctcctgctgctggagggcgctgtcattgtctatcagctgtactccctaatgtcctctgaaaagtggcaccagaccatctcgctggccctcatcctcttcagcaactactatgccttcttcaagctgctccgggaccgcttggtattgggcaaggcctactcatactctgctagcccccagagagacctggaccaccgtttctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SERTA domain containing 1 - transmembrane protein 174 - MAF1 homolog (S. cerevisiae) - transmembrane protein 55A |