FGF18-fibroblast growth factor 18 Gene View larger

FGF18-fibroblast growth factor 18 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FGF18-fibroblast growth factor 18 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FGF18-fibroblast growth factor 18 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006245
Product type: DNA & cDNA
Ncbi symbol: FGF18
Origin species: Human
Product name: FGF18-fibroblast growth factor 18 Gene
Size: 2ug
Accessions: BC006245
Gene id: 8817
Gene description: fibroblast growth factor 18
Synonyms: FGF-18; ZFGF5; fibroblast growth factor 18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtattcagcgccctccgcctgcacttgcctgtgtttacacttcctgctgctgtgcttccaggtacaggtgctggttgccgaggagaacgtggacttccgcatccacgtggagaaccagacgcgggctcgggacgatgtgagccgtaagcagctgcggctgtaccagctctacagccggaccagtgggaaacacatccaggtcctgggccgcaggatcagtgcccgcggcgaggatggggacaagtatgcccagctcctagtggagacagacaccttcggtagtcaagtccggatcaagggcaaggagacggaattctacctgtgcatgaaccgcaaaggcaagctcgtggggaagcccgatggcaccagcaaggagtgtgtgttcatcgagaaggttctggagaacaactacacggccctgatgtcggctaagtactccggctggtacgtgggcttcaccaagaaggggcggccgcggaagggccccaagacccgggagaaccagcaggacgtgcatttcatgaagcgctaccccaaggggcagccggagcttcagaagcccttcaagtacacgacggtgaccaagaggtcccgtcggatccggcccacacaccctgcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fibroblast growth factor 21
- transmembrane protein 217
- transmembrane protein 204
- PQ loop repeat containing 2

Buy FGF18-fibroblast growth factor 18 Gene now

Add to cart