FGF21-fibroblast growth factor 21 Gene View larger

FGF21-fibroblast growth factor 21 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FGF21-fibroblast growth factor 21 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FGF21-fibroblast growth factor 21 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018404
Product type: DNA & cDNA
Ncbi symbol: FGF21
Origin species: Human
Product name: FGF21-fibroblast growth factor 21 Gene
Size: 2ug
Accessions: BC018404
Gene id: 26291
Gene description: fibroblast growth factor 21
Synonyms: fibroblast growth factor 21
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactcggacgagaccgggttcgagcactcagggctgtgggtttctgtgctggctggtcttctgctgggagcctgccaggcacaccccatccctgactccagtcctctcctgcaattcgggggccaagtccggcagcggtacctctacacagatgatgcccagcagacagaagcccacctggagatcagggaggatgggacggtggggggcgctgctgaccagagccccgaaagtctcctgcagctgaaagccttgaagccgggagttattcaaatcttgggagtcaagacatccaggttcctgtgccagcggccagatggggccctgtatggatcgctccactttgaccctgaggcctgcagcttccgggagctgcttcttgaggacggatacaatgtttaccagtccgaagcccacggcctcccgctgcacctgccagggaacaagtccccacaccgggaccctgcaccccgaggaccagctcgcttcctgccactaccaggcctgccccccgcacccccggagccacccggaatcctggccccccagccccccgatgtgggctcctcggaccctctgagcatggtgggaccttcccagggccgaagccccagctacgcttcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 217
- transmembrane protein 204
- PQ loop repeat containing 2
- transmembrane protein 39B

Buy FGF21-fibroblast growth factor 21 Gene now

Add to cart