METTL7B-methyltransferase like 7B Gene View larger

METTL7B-methyltransferase like 7B Gene

PTXBC020509

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of METTL7B-methyltransferase like 7B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about METTL7B-methyltransferase like 7B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020509
Product type: DNA & cDNA
Ncbi symbol: METTL7B
Origin species: Human
Product name: METTL7B-methyltransferase like 7B Gene
Size: 2ug
Accessions: BC020509
Gene id: 196410
Gene description: methyltransferase like 7B
Synonyms: ALDI; methyltransferase-like protein 7B; associated with lipid droplets 1; methyltransferase like 7B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagcaagaaacgggagctcttcagccagataaaggggcttacaggagcctccgggaaagtggccctactggagctgggctgcggaaccggagccaactttcagttctacccaccgggctgcagggtcacctgcctagacccaaatccccactttgagaagttcctgacaaagagcatggctgagaacaggcacctccaatatgagcggtttgtggtggctcctggagaggacatgagacagctggctgatggctccatggatgtggtggtctgcactctggtgctgtgctctgtgcagagcccaaggaaggtcctgcaggaggtccggagagtactgagaccgggaggtgtgctctttttctgggagcatgtggcagaaccatatggaagctgggccttcatgtggcagcaagttttcgagcccacctggaaacacattggggatggctgctgcctcaccagagagacctggaaggatcttgagaacgcccagttctccgaaatccaaatggaacgacagccccctcccttgaagtggctacctgttgggccccacatcatgggaaaggctgtcaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fibroblast growth factor 18
- fibroblast growth factor 21
- transmembrane protein 217
- transmembrane protein 204

Buy METTL7B-methyltransferase like 7B Gene now

Add to cart