Login to display prices
Login to display prices
FXYD5-FXYD domain containing ion transport regulator 5 Gene View larger

FXYD5-FXYD domain containing ion transport regulator 5 Gene

PTXBC009642

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FXYD5-FXYD domain containing ion transport regulator 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FXYD5-FXYD domain containing ion transport regulator 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009642
Product type: DNA & cDNA
Ncbi symbol: FXYD5
Origin species: Human
Product name: FXYD5-FXYD domain containing ion transport regulator 5 Gene
Size: 2ug
Accessions: BC009642
Gene id: 53827
Gene description: FXYD domain containing ion transport regulator 5
Synonyms: DYSAD; HSPC113; IWU1; KCT1; OIT2; PRO6241; RIC; FXYD domain-containing ion transport regulator 5; keratinocytes associated transmembrane protein 1; FXYD domain containing ion transport regulator 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgccctctggtcgcctgtgtcttcttaccatcgttggcctgattctccccaccagaggacagacgttgaaagataccacgtccagttcttcagcagactcaactatcatggacattcaggtcccgacacgagccccagatgcagtctacacagaactccagcccacctctccaaccccaacctggcctgctgatgaaacaccacaaccccagacccagacccagcaactggaaggaacggatgggcctctagtgacagatccagagacacacaagagcaccaaagcagctcatcccactgatgacaccacgacgctctctgagagaccatccccaagcacagacgtccagacagacccccagaccctcaagccatctggttttcatgaggatgaccccttcttctatgatgaacacaccctccggaaacgggggctgttggtcgcagctgtgctgttcatcacaggcatcatcatcctcaccagtggcaagtgcaggcagctgtcccggttatgccggaatcattgcaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - linker for activation of T cells family, member 2
- protein kinase, cAMP-dependent, catalytic, beta
- ATPase, Na+/K+ transporting, beta 3 polypeptide
- hairy/enhancer-of-split related with YRPW motif 1