ATP1B3-ATPase, Na+/K+ transporting, beta 3 polypeptide Gene View larger

ATP1B3-ATPase, Na+/K+ transporting, beta 3 polypeptide Gene

PTXBC011835

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP1B3-ATPase, Na+/K+ transporting, beta 3 polypeptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP1B3-ATPase, Na+/K+ transporting, beta 3 polypeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011835
Product type: DNA & cDNA
Ncbi symbol: ATP1B3
Origin species: Human
Product name: ATP1B3-ATPase, Na+/K+ transporting, beta 3 polypeptide Gene
Size: 2ug
Accessions: BC011835
Gene id: 483
Gene description: ATPase, Na+/K+ transporting, beta 3 polypeptide
Synonyms: ATPB-3; CD298; sodium/potassium-transporting ATPase subunit beta-3; ATPase, Na+/K+ transporting, beta 3 polypeptide; Na, K-ATPase beta-3 polypeptide; sodium pump subunit beta-3; sodium-potassium ATPase subunit beta 3 (non-catalytic); sodium/potassium-dependent ATPase subunit beta-3; sodium/potassium-transporting ATPase beta-3 chain; ATPase Na+/K+ transporting subunit beta 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgaagaacgagaagaagtccctcaaccagagcctggccgagtggaagctcttcatctacaacccgaccaccggagaattcctggggcgcaccgccaagagctggggtttgatcttgctcttctacctagttttttatgggttcctggctgcactcttctcattcacgatgtgggttatgcttcagactctcaacgatgaggttccaaaataccgtgaccagattcctagcccaggactcatggtttttccaaaaccagtgaccgcattggaatatacattcagtaggtctgatccaacttcgtatgcagggtacattgaagaccttaagaagtttctaaaaccatatactttagaagaacagaagaacctcacagtctgtcctgatggagcactttttgaacagaagggtccagtttatgttgcatgtcagtttcctatttcattacttcaagcatgcagtggtatgaatgatcctgattttggctattctcaaggaaacccttgtattcttgtgaaaatgaacagaataattggattaaagcctgaaggagtgccaaggatagattgtgtttcaaagaatgaagatataccaaatgtagcagtttatcctcataatggaatgatagacttaaaatatttcccatattatgggaaaaaactgcatgttgggtatctacagccattggttgctgttcaggtcagctttgctcctaacaacactgggaaagaagtaacagttgagtgcaagattgatggatcagccaacctaaaaagtcaggatgatcgtgacaagtttttgggacgagttatgttcaaaatcacagcacgtgcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hairy/enhancer-of-split related with YRPW motif 1
- eukaryotic translation elongation factor 1 gamma
- phytanoyl-CoA 2-hydroxylase interacting protein
- electron-transfer-flavoprotein, alpha polypeptide

Buy ATP1B3-ATPase, Na+/K+ transporting, beta 3 polypeptide Gene now

Add to cart