EEF1G-eukaryotic translation elongation factor 1 gamma Gene View larger

EEF1G-eukaryotic translation elongation factor 1 gamma Gene

PTXBC007949

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EEF1G-eukaryotic translation elongation factor 1 gamma Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EEF1G-eukaryotic translation elongation factor 1 gamma Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007949
Product type: DNA & cDNA
Ncbi symbol: EEF1G
Origin species: Human
Product name: EEF1G-eukaryotic translation elongation factor 1 gamma Gene
Size: 2ug
Accessions: BC007949
Gene id: 1937
Gene description: eukaryotic translation elongation factor 1 gamma
Synonyms: EF1G; GIG35; elongation factor 1-gamma; EF-1-gamma; PRO1608; eEF-1B gamma; pancreatic tumor-related protein; translation elongation factor eEF-1 gamma chain; eukaryotic translation elongation factor 1 gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaccacaacaaacaggccactgagaatgcaaaggaggaagtgaggcgaattctggggctgctggatgcttacttgaagacgaggacttttctggtgggcgaacgagtgacattggctgacatcacagttgtctgcaccctgttgtggctctataagcaggttctagagccttctttccgccaggcctttcccaataccaaccgctggttcctcacctgcattaaccagccccagttccgggctgtcttgggcgaagtgaaactgtgtgagaagatggcccagtttgatgctaaaaagtttgcagagacccaacctaaaaaggacacaccacggaaagagaagggttcacgggaagagaagcagaagccccaggctgagcggaaggaggagaaaaaggcggctgcccctgctcctgaggaggagatggatgaatgtgagcaggcgctggctgctgagcccaaggccaaggaccccttcgctcacctgcccaagagtacctttgtgttggatgaatttaagcgcaagtactccaatgaggacacactctctgtggcactgccatatttctgggagcactttgataaggacggctggtccctgtggtactcagagtatcgcttccctgaagaactcactcagaccttcatgagctgcaatctcatcactggaatgttccagcgactggacaagctgaggaagaatgccttcgccagtgtcatcctttttggaaccaacaatagcagctccatttctggagtctgggtcttccgaggccaggagcttgcctttccgctgagtccagattggcaggtggactacgagtcatacacatggcggaaactggatcctggcagcgaggagacccagacgctggttcgagagtacttttcctgggagggggccttccagcatgtgggcaaagccttcaatcagggcaagatcttcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phytanoyl-CoA 2-hydroxylase interacting protein
- electron-transfer-flavoprotein, alpha polypeptide
- hairy/enhancer-of-split related with YRPW motif 2
- protein kinase, cAMP-dependent, catalytic, beta

Buy EEF1G-eukaryotic translation elongation factor 1 gamma Gene now

Add to cart