HEY2-hairy/enhancer-of-split related with YRPW motif 2 Gene View larger

HEY2-hairy/enhancer-of-split related with YRPW motif 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HEY2-hairy/enhancer-of-split related with YRPW motif 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HEY2-hairy/enhancer-of-split related with YRPW motif 2 Gene

Proteogenix catalog: PTXBC007707
Ncbi symbol: HEY2
Product name: HEY2-hairy/enhancer-of-split related with YRPW motif 2 Gene
Size: 2ug
Accessions: BC007707
Gene id: 23493
Gene description: hairy/enhancer-of-split related with YRPW motif 2
Synonyms: CHF1; GRIDLOCK; GRL; HERP1; HESR2; HRT2; bHLHb32; hairy/enhancer-of-split related with YRPW motif protein 2; HES-related repressor protein 1; HES-related repressor protein 2; HESR-2; HRT-2; cardiovascular basic helix-loop-helix factor 1; cardiovascular helix-loop-helix factor 1; class B basic helix-loop-helix protein 32; hCHF1; hHRT2; hairy and enhancer of split-related protein 2; hairy-related transcription factor 2; hairy/enhancer-of-split related with YRPW motif 2; protein gridlock homolog; hes related family bHLH transcription factor with YRPW motif 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcgcccctgcgaggagacgacctccgagagcgacatggacgagaccatcgacgtggggagcgagaacaattactcggggcaaagtactagctctgtgattagattgaattctccaacaacaacatctcagattatggcaagaaagaaaaggagagggattatagagaaaaggcgtcgggatcggataaataacagtttatctgagttgagaagacttgtgccaactgcttttgaaaaacaaggatctgcaaagttagaaaaagctgaaatattgcaaatgacagtggatcatttgaagatgcttcaggcaacagggggtaaaggctactttgacgcacacgctcttgccatggacttcatgagcataggattccgagagtgcctaacagaagttgcgcggtacctgagctccgtggaaggcctggactcctcggatccgctgcgggtgcggcttgtgtctcatctcagcacttgcgccacccagcgggaggcggcggccatgacatcctccatggcccaccaccatcatccgctccacccgcatcactgggccgccgccttccaccacctgcccgcagccctgctccagcccaacggcctccatgcctcagagtcaaccccttgtcgcctctccacaacttcagaagtgcctcctgcccacggctctgctctcctcacggccacgtttgcccatgcggattcagccctccgaatgccatccacgggcagcgtcgccccctgcgtgccacctctctccacctctctcttgtccctctctgccaccgtccacgccgcagccgcagcagccaccgcggctgcacacagcttccctctgtccttcgcgggggcattccccatgcttcccccaaacgcagcagcagcagtggccgcggccacagccatcagcccgcccttgtcagtatcagccacgtccagtcctcagcagaccagcagtggaacaaacaataaaccttaccgaccctgggggacagaagttggagctttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

Buy HEY2-hairy/enhancer-of-split related with YRPW motif 2 Gene now

Add to cart