Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HEY1-hairy/enhancer-of-split related with YRPW motif 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HEY1-hairy/enhancer-of-split related with YRPW motif 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001873 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HEY1 |
| Origin species: | Human |
| Product name: | HEY1-hairy/enhancer-of-split related with YRPW motif 1 Gene |
| Size: | 2ug |
| Accessions: | BC001873 |
| Gene id: | 23462 |
| Gene description: | hairy/enhancer-of-split related with YRPW motif 1 |
| Synonyms: | BHLHb31; CHF2; HERP2; HESR1; HRT-1; OAF1; hHRT1; hairy/enhancer-of-split related with YRPW motif protein 1; HES-related repressor protein 1; HES-related repressor protein 2; basic helix-loop-helix protein OAF1; cardiovascular helix-loop-helix factor 2; class B basic helix-loop-helix protein 31; hairy and enhancer of split-related protein 1; hairy-related transcription factor 1; hairy/enhancer-of-split related with YRPW motif 1; hes related family bHLH transcription factor with YRPW motif 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagcgagctcaccccgagtacagctcctcggacagcgagctggacgagaccatcgaggtggagaaggagagtgcggacgagaatggaaacttgagttcggctctaggttccatgtccccaactacatcttcccagattttggccagaaaaagacggagaggaataattgagaagcgccgacgagaccggatcaataacagtttgtctgagctgagaaggctggtacccagtgcttttgagaagcagggatctgctaagctagaaaaagccgagatcctgcagatgaccgtggatcacctgaaaatgctgcatacggcaggagggaaaggttactttgacgcgcacgcccttgctatggactatcggagtttgggatttcgggaatgcctggcagaagttgcgcgttatctgagcatcattgaaggactagatgcctctgacccgcttcgagttcgactggtttcgcatctcaacaactacgcttcccagcgggaagccgcgagcggcgcccacgcgggcctcggacacattccctgggggaccgtcttcggacatcacccgcacatcgcgcacccgctgttgctgccccagaacggccacgggaacgcgggcaccacggcctcacccacggaaccgcaccaccagggcaggctgggctcggcacatccggaggcgcctgctttgcgagcgccccctagcggcagcctcggaccggtgctccctgtggtcacctccgcctccaaactgtcgccgcctctgctctcctcagtggcctccctgtcggccttccccttctctttcggctccttccacttactgtctcccaatgcactgagcccttcagcacccacgcaggctgcaaaccttggcaagccctatagaccttgggggacggagatcggagctttttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation elongation factor 1 gamma - phytanoyl-CoA 2-hydroxylase interacting protein - electron-transfer-flavoprotein, alpha polypeptide - hairy/enhancer-of-split related with YRPW motif 2 |