Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LAT2-linker for activation of T cells family, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LAT2-linker for activation of T cells family, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001609 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LAT2 |
| Origin species: | Human |
| Product name: | LAT2-linker for activation of T cells family, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC001609 |
| Gene id: | 7462 |
| Gene description: | linker for activation of T cells family, member 2 |
| Synonyms: | HSPC046; LAB; NTAL; WBSCR15; WBSCR5; WSCR5; linker for activation of T-cells family member 2; Williams-Beuren syndrome chromosomal region 15 protein; Williams-Beuren syndrome chromosomal region 5 protein; linker for activation of B-cells; linker for activation of T cells, transmembrane adaptor 2; membrane-associated adapter molecule; non-T-cell activation linker |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagctcggggactgaactgctgtggcccggagcagcgctgctggtgctgttgggggtggcagccagtctgtgtgtgcgctgctcacgcccaggtgcaaagaggtcagagaaaatctaccagcagagaagtctgcgtgaggaccaacagagctttacggggtcccggacctactccttggtcgggcaggcatggccaggacccctggcggacatggcacccacaaggaaggacaagctgttgcaattctaccccagcctggaggatccagcatcttccaggtaccagaacttcagcaaaggaagcagacacgggtcggaggaagcctacatagaccccattgccatggagtattacaactgggggcggttctcgaagcccccagaagatgatgatgccaattcctacgagaatgtgctcatttgcaagcagaaaaccacagagacaggtgcccagcaggagggcataggtggcctctgcagaggggacctcagcctgtcactggccctgaagactggccccacttctggtctctgtccctctgcctccccggaagaagatgaggaatctgaggattatcagaactcagcatccatccatcagtggcgcgagtccaggaaggtcatggggcaactccagagagaagcatcccctggcccggtgggaagcccagacgaggaggacggggaaccggattacgtgaatggggaggtggcagccacagaagcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein kinase, cAMP-dependent, catalytic, beta - ATPase, Na+/K+ transporting, beta 3 polypeptide - hairy/enhancer-of-split related with YRPW motif 1 - eukaryotic translation elongation factor 1 gamma |