Login to display prices
Login to display prices
PRKACB-protein kinase, cAMP-dependent, catalytic, beta Gene View larger

PRKACB-protein kinase, cAMP-dependent, catalytic, beta Gene

PTXBC016285

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRKACB-protein kinase, cAMP-dependent, catalytic, beta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRKACB-protein kinase, cAMP-dependent, catalytic, beta Gene

Proteogenix catalog: PTXBC016285
Ncbi symbol: PRKACB
Product name: PRKACB-protein kinase, cAMP-dependent, catalytic, beta Gene
Size: 2ug
Accessions: BC016285
Gene id: 5567
Gene description: protein kinase, cAMP-dependent, catalytic, beta
Synonyms: PKA C-beta; PKACB; cAMP-dependent protein kinase catalytic subunit beta; cAMP-dependent protein kinase catalytic beta subunit isoform 4ab; protein kinase A catalytic subunit beta; protein kinase, cAMP-dependent, beta catalytic subunit; protein kinase, cAMP-dependent, catalytic, beta; protein kinase cAMP-activated catalytic subunit beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaacgcggcgaccgccaagaaaggcagcgaggtggagagcgtgaaagagtttctagccaaagccaaagaagactttttgaaaaaatgggagaatccaactcagaataatgccggacttgaagattttgaaaggaaaaaaacccttggaacaggttcatttggaagagtcatgttggtaaaacacaaagccactgaacagtattatgccatgaagatcttagataagcagaaggttgttaaactgaagcaaatagagcatactttgaatgagaaaagaatattacaggcagtgaattttcctttccttgttcgactggagtatgcttttaaggataattctaatttatacatggttatggaatatgtccctgggggtgaaatgttttcacatctaagaagaattggaaggttcagtgagccccatgcacggttctatgcagctcagatagtgctaacattcgagtacctccattcactagacctcatctacagagatctaaaacctgaaaatctcttaattgaccatcaaggctatatccaggtcacagactttgggtttgccaaaagagttaaaggcagaacttggacattatgtggaactccagagtatttggctccagaaataattctcagcaagggctacaataaggcagtggattggtgggcattaggagtgctaatctatgaaatggcagctggctatcccccattctttgcagaccaaccaattcagatttatgaaaagattgtttctggaaagaacttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: