Login to display prices
Login to display prices
PCNP-PEST proteolytic signal containing nuclear protein Gene View larger

PCNP-PEST proteolytic signal containing nuclear protein Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCNP-PEST proteolytic signal containing nuclear protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PCNP-PEST proteolytic signal containing nuclear protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022001
Product type: DNA & cDNA
Ncbi symbol: PCNP
Origin species: Human
Product name: PCNP-PEST proteolytic signal containing nuclear protein Gene
Size: 2ug
Accessions: BC022001
Gene id: 57092
Gene description: PEST proteolytic signal containing nuclear protein
Synonyms: PEST proteolytic signal-containing nuclear protein; PEST-containing nuclear protein; PEST proteolytic signal containing nuclear protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacgggaaggcgggagacgagaagcctgaaaagtcgcagcgagctggagccgccggaggacctgaagaagaagcagaaaaacctgtgaaaactaagactgtttcttccagtaatggaggggaaagttccagtcgcagcgctgagaagcgatcagctgaagaagaagctgccgacctcccaacaaagcctacaaagatctccaagtttggatttgccataggtagtcagacgacaaagaaagcatcagccatatccatcaaacttggatcaagtaagcctaaagaaactgttccaactcttgctccaaaaactctttcagtagcagcagcttttaatgaagatgaagatagtgaaccagaggaaatgcctcaagaagcaaagatgaggatgaagaatattggaagggatacaccaacatcagctggaccaaactcattcaataaaggaaagcatgggttttctgataaccagaagctgtgggagcgaaatataaaatctcatcttggaaatgtccatgaccaagacaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - V-set and transmembrane domain containing 2 like
- pseudouridylate synthase 7 homolog (S. cerevisiae)
- chromobox homolog 2 (Pc class homolog, Drosophila)
- family with sequence similarity 177, member A1