Login to display prices
Login to display prices
BCL2A1-BCL2-related protein A1 Gene View larger

BCL2A1-BCL2-related protein A1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BCL2A1-BCL2-related protein A1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BCL2A1-BCL2-related protein A1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016281
Product type: DNA & cDNA
Ncbi symbol: BCL2A1
Origin species: Human
Product name: BCL2A1-BCL2-related protein A1 Gene
Size: 2ug
Accessions: BC016281
Gene id: 597
Gene description: BCL2-related protein A1
Synonyms: ACC-1; ACC-2; ACC1; ACC2; BCL2L5; BFL1; GRS; HBPA1; bcl-2-related protein A1; bcl-2-like protein 5; bcl2-L-5; hematopoietic BCL2-related protein A1; hemopoietic-specific early response protein; protein BFL-1; BCL2 related protein A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtgcgtcctacagataccacaacctggatcaggtccaagcaaaacgtccagagtgctacaaaatgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagtcatgcttggacaatgttaatgttgtgtccgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaagacggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcaaattgccccggatgtggatacctataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatggataaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagttacaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADP-ribosylation factor 4
- ring finger protein 208
- zinc finger protein 655
- zinc finger protein 614