Login to display prices
Login to display prices
MYL7-myosin, light chain 7, regulatory Gene View larger

MYL7-myosin, light chain 7, regulatory Gene

PTXBC027915

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MYL7-myosin, light chain 7, regulatory Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MYL7-myosin, light chain 7, regulatory Gene

Proteogenix catalog: PTXBC027915
Ncbi symbol: MYL7
Product name: MYL7-myosin, light chain 7, regulatory Gene
Size: 2ug
Accessions: BC027915
Gene id: 58498
Gene description: myosin, light chain 7, regulatory
Synonyms: MYL2A; MYLC2A; myosin regulatory light chain 2, atrial isoform; MLC-2a; MLC2a; myosin light chain 2a; myosin regulatory light chain 7; myosin, light chain 7, regulatory; myosin, light polypeptide 7, regulatory; myosin light chain 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagcaggaaggcggggacccggggcaaggtggcagccaccaagcaggcccaacgtggttcttccaacgtcttttccatgtttgaacaagcccagatacaggagttcaaagaagccttcagctgtatcgaccagaatcgtgatggcatcatctgcaaggcagacctgagggagacctactcccagctggggaaggtgagtgtcccagaggaggagctggacgccatgctgcaagagggcaagggccccatcaacttcaccgtcttcctcacgctctttggggagaagctcaatgggacagaccccgaggaagccatcctgagtgccttccgcatgtttgaccccagcggcaaaggggtggtgaacaaggatgagttcaagcagcttctcctgacccaggcagacaagttctctccagctgaggtggagcagatgttcgccctgacacccatggacctggcggggaacatcgactacaagtcactgtgctacatcatcacccatggagacgagaaagaggaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice