WRB-tryptophan rich basic protein Gene View larger

WRB-tryptophan rich basic protein Gene

PTXBC012415

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WRB-tryptophan rich basic protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WRB-tryptophan rich basic protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012415
Product type: DNA & cDNA
Ncbi symbol: WRB
Origin species: Human
Product name: WRB-tryptophan rich basic protein Gene
Size: 2ug
Accessions: BC012415
Gene id: 7485
Gene description: tryptophan rich basic protein
Synonyms: tail-anchored protein insertion receptor WRB; CHD5; GET1; congenital heart disease 5 protein; tryptophan rich basic protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctcagccgcggccgaccactgggcgtggttgctggtgctcagcttcgtgtttggatgcaatgttcttaggatcctcctcccgtccttctcatccttcatgtccagggtgctgcagaaggacgcggagcaggagtcacagatgagagcggagatccaggacatgaagcaggagctctccacagtcaacatgatggacgagtttgccagatatgccaggctggaaagaaagatcaacaagatgacggataagctcaaaacccatgtgaaagctcggacagctcaattagccaagataaaatgggtgataagtgtcgctttctacgtattgcaggctgccctgatgatctcactcatttggaagtattattctgtccctgtggctgtcgtgccgagtaaatggataacccccctagaccgcctggtagcctttcctactagagtagcaggtggtgttggaattacctgttggattttagtctgtaacaaagttgtcgctattgtgcttcatccgttcagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mediator complex subunit 30
- methyltransferase like 7B
- fibroblast growth factor 18
- fibroblast growth factor 21

Buy WRB-tryptophan rich basic protein Gene now

Add to cart