Login to display prices
Login to display prices
RBM8A-RNA binding motif protein 8A Gene View larger

RBM8A-RNA binding motif protein 8A Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBM8A-RNA binding motif protein 8A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RBM8A-RNA binding motif protein 8A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017088
Product type: DNA & cDNA
Ncbi symbol: RBM8A
Origin species: Human
Product name: RBM8A-RNA binding motif protein 8A Gene
Size: 2ug
Accessions: BC017088
Gene id: 9939
Gene description: RNA binding motif protein 8A
Synonyms: ribonucleoprotein RBM8A; BOV-1A; BOV-1B; BOV-1C; C1DELq21.1; DEL1q21.1; MDS014; RBM8; RBM8B; TAR; Y14; ZNRP; ZRNP1; RNA-binding protein 8A; BOV-1; RNA binding motif protein 8B; RNA-binding protein Y14; binder of OVCA1-1; ribonucleoprotein RBM8; RNA binding motif protein 8A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacgtgctagatcttcacgaggctgggggcgaagatttcgccatggatgaggatggggacgagagcattcacaaactgaaagaaaaagcgaagaaacggaagggtcgcggctttggctccgaagaggggtcccgagcgcggatgcgtgaggattatgacagcgtggagcaggatggcgatgaacccggaccacaacgctctgttgaaggctggattctctttgtaactggagtccatgaggaagccaccgaagaagacatacacgacaaattcgcagaatatggggaaattaaaaacattcatctcaacctcgacaggcgaacaggatatctgaaggggtatactctagttgaatatgaaacatacaaggaagcccaggctgctatggagggactcaatggccaggatttgatgggacagcccatcagcgttgactggtgttttgttcggggtccaccaaaaggcaagaggagaggtggccgaagacgcagcagaagtccagaccggagacgtcgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ferritin, heavy polypeptide 1
- sperm associated antigen 16
- PERP, TP53 apoptosis effector
- SAPS domain family, member 3