SAPS3-SAPS domain family, member 3 Gene View larger

SAPS3-SAPS domain family, member 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SAPS3-SAPS domain family, member 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SAPS3-SAPS domain family, member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020953
Product type: DNA & cDNA
Ncbi symbol: SAPS3
Origin species: Human
Product name: SAPS3-SAPS domain family, member 3 Gene
Size: 2ug
Accessions: BC020953
Gene id: 55291
Gene description: SAPS domain family, member 3
Synonyms: SAPS3; C11orf23; PP6R3; SAP190; SAPL; SAPLa; serine/threonine-protein phosphatase 6 regulatory subunit 3; SAPS domain family, member 3; sporulation-induced transcript 4-associated protein SAPL; protein phosphatase 6 regulatory subunit 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggtggacctgagtgaaccacccaactggtcagctaactttgatgtcccaatggaaacaacccacggtgctccattggattctgtgggatctgatgtctggagcacagaggagccgatgccaactaaagagacgggctgggcttctttttcagagttcacgtcttccctgagcacaaaagattctttaaggagtaattctccagtggaaatggaaaccagcactgaacccatggaccctctgactcccagtgcggctgccctggcagtgcagccagaagcggcaggcagtgtggccatggaagccagctctgacggagaggaggatgcagaaagtacagacaaggtaactgagacagtgatgaatggcggcatgaaggaaacgctcagcctcactgtagatgccaagacagagactgcggtcttcaaaagtgaggaagggaaactgtctacctctcaagatgctgcttgtaaagacgcagaggagtgtcccgagactgcagaggcgaagtgcgcggcgcccaggcctcccagcagcagtcccgagcagaggactggccaaccaagcgcaccaggtgacacttcagtgaatggccctgtatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Josephin domain containing 1
- integral membrane protein 2C
- diablo homolog (Drosophila)
- Yip1 domain family, member 4

Buy SAPS3-SAPS domain family, member 3 Gene now

Add to cart