Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SAPS3-SAPS domain family, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SAPS3-SAPS domain family, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020953 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SAPS3 |
| Origin species: | Human |
| Product name: | SAPS3-SAPS domain family, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC020953 |
| Gene id: | 55291 |
| Gene description: | SAPS domain family, member 3 |
| Synonyms: | SAPS3; C11orf23; PP6R3; SAP190; SAPL; SAPLa; serine/threonine-protein phosphatase 6 regulatory subunit 3; SAPS domain family, member 3; sporulation-induced transcript 4-associated protein SAPL; protein phosphatase 6 regulatory subunit 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggtggacctgagtgaaccacccaactggtcagctaactttgatgtcccaatggaaacaacccacggtgctccattggattctgtgggatctgatgtctggagcacagaggagccgatgccaactaaagagacgggctgggcttctttttcagagttcacgtcttccctgagcacaaaagattctttaaggagtaattctccagtggaaatggaaaccagcactgaacccatggaccctctgactcccagtgcggctgccctggcagtgcagccagaagcggcaggcagtgtggccatggaagccagctctgacggagaggaggatgcagaaagtacagacaaggtaactgagacagtgatgaatggcggcatgaaggaaacgctcagcctcactgtagatgccaagacagagactgcggtcttcaaaagtgaggaagggaaactgtctacctctcaagatgctgcttgtaaagacgcagaggagtgtcccgagactgcagaggcgaagtgcgcggcgcccaggcctcccagcagcagtcccgagcagaggactggccaaccaagcgcaccaggtgacacttcagtgaatggccctgtatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Josephin domain containing 1 - integral membrane protein 2C - diablo homolog (Drosophila) - Yip1 domain family, member 4 |