Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PERP-PERP, TP53 apoptosis effector Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PERP-PERP, TP53 apoptosis effector Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010163 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PERP |
| Origin species: | Human |
| Product name: | PERP-PERP, TP53 apoptosis effector Gene |
| Size: | 2ug |
| Accessions: | BC010163 |
| Gene id: | 64065 |
| Gene description: | PERP, TP53 apoptosis effector |
| Synonyms: | PERP, TP53 apoptosis effector; KCP1; KRTCAP1; PIGPC1; THW; dJ496H19.1; p53 apoptosis effector related to PMP-22; 1110017A08Rik; KCP-1; keratinocyte-associated protein 1; keratinocytes associated protein 1; p53 apoptosis effector related to PMP22; p53-induced protein PIGPC1; transmembrane protein THW |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatccgctgcggcctggcctgcgagcgctgccgctggatcctgcccctgctcctactcagcgccatcgccttcgacatcatcgcgctggccggccgcggctggttgcagtctagcgaccacggccagacgtcctcgctgtggtggaaatgctcccaagagggcggcggcagcgggtcctacgaggagggctgtcagagcctcatggagtacgcgtggggtagagcagcggctgccatgctcttctgtggcttcatcatcctggtgatctgtttcatcctctccttcttcgccctctgtggaccccagatgcttgtcttcctgagagtgattggaggtctccttgccttggctgctgtgttccagatcatctccctggtaatttaccccgtgaagtacacccagaccttcacccttcatgccaaccctgctgtcacttacatctataactgggcctacggctttgggtgggcagccacgattatcctgattggctgtgccttcttcttctgctgcctccccaactacgaagatgaccttctgggcaatgccaagcccaggtacttctacacatctgcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SAPS domain family, member 3 - Josephin domain containing 1 - integral membrane protein 2C - diablo homolog (Drosophila) |