Login to display prices
Login to display prices
PERP-PERP, TP53 apoptosis effector Gene View larger

PERP-PERP, TP53 apoptosis effector Gene

PTXBC010163

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PERP-PERP, TP53 apoptosis effector Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PERP-PERP, TP53 apoptosis effector Gene

Proteogenix catalog: PTXBC010163
Ncbi symbol: PERP
Product name: PERP-PERP, TP53 apoptosis effector Gene
Size: 2ug
Accessions: BC010163
Gene id: 64065
Gene description: PERP, TP53 apoptosis effector
Synonyms: PERP, TP53 apoptosis effector; KCP1; KRTCAP1; PIGPC1; THW; dJ496H19.1; p53 apoptosis effector related to PMP-22; 1110017A08Rik; KCP-1; keratinocyte-associated protein 1; keratinocytes associated protein 1; p53 apoptosis effector related to PMP22; p53-induced protein PIGPC1; transmembrane protein THW
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatccgctgcggcctggcctgcgagcgctgccgctggatcctgcccctgctcctactcagcgccatcgccttcgacatcatcgcgctggccggccgcggctggttgcagtctagcgaccacggccagacgtcctcgctgtggtggaaatgctcccaagagggcggcggcagcgggtcctacgaggagggctgtcagagcctcatggagtacgcgtggggtagagcagcggctgccatgctcttctgtggcttcatcatcctggtgatctgtttcatcctctccttcttcgccctctgtggaccccagatgcttgtcttcctgagagtgattggaggtctccttgccttggctgctgtgttccagatcatctccctggtaatttaccccgtgaagtacacccagaccttcacccttcatgccaaccctgctgtcacttacatctataactgggcctacggctttgggtgggcagccacgattatcctgattggctgtgccttcttcttctgctgcctccccaactacgaagatgaccttctgggcaatgccaagcccaggtacttctacacatctgcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice