FTH1-ferritin, heavy polypeptide 1 Gene View larger

FTH1-ferritin, heavy polypeptide 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FTH1-ferritin, heavy polypeptide 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FTH1-ferritin, heavy polypeptide 1 Gene

Proteogenix catalog: PTXBC000857
Ncbi symbol: FTH1
Product name: FTH1-ferritin, heavy polypeptide 1 Gene
Size: 2ug
Accessions: BC000857
Gene id: 2495
Gene description: ferritin, heavy polypeptide 1
Synonyms: FHC; FTH; FTHL6; HFE5; PIG15; PLIF; ferritin heavy chain; apoferritin; cell proliferation-inducing gene 15 protein; ferritin H subunit; ferritin, heavy polypeptide 1; placenta immunoregulatory factor; proliferation-inducing protein 15; ferritin heavy chain 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgaccgcgtccacctcgcaggtgcgccagaactaccaccaggactcagaggccgccatcaaccgccagatcaacctggagctctacgcctcctacgtttacctgtccatgtcttactactttgaccgcgatgatgtggctttgaagaactttgccaaatactttcttcaccaatctcatgaggagagggaacatgctgagaaactgatgaagctgcagaaccaacgaggtggccgaatcttccttcaggatatcaagaaaccagactgtgatgactgggagagcgggctgaatgcaatggagtgtgcattacatttggaaaaaaatgtgaatcagtcactactggaactgcacaaactggccactgacaaaaatgacccccatttgtgtgacttcattgagacacattacctgaatgagcaggtgaaagccatcaaagaattgggtgaccacgtgaccaacttgcgcaagatgggagcgcccgaatctggcttggcggaatatctctttgacaagcacaccctgggagacagtgataatgaaagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

Buy FTH1-ferritin, heavy polypeptide 1 Gene now

Add to cart