SPAG16-sperm associated antigen 16 Gene View larger

SPAG16-sperm associated antigen 16 Gene

PTXBC009614

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPAG16-sperm associated antigen 16 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPAG16-sperm associated antigen 16 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009614
Product type: DNA & cDNA
Ncbi symbol: SPAG16
Origin species: Human
Product name: SPAG16-sperm associated antigen 16 Gene
Size: 2ug
Accessions: BC009614
Gene id: 79582
Gene description: sperm associated antigen 16
Synonyms: WDR29; sperm-associated antigen 16 protein; WD repeat domain 29; pf20 protein homolog; sperm-associated WD repeat protein; sperm associated antigen 16
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgctcagcgagggatgcccagctccgccgtgagggtcctggaagaggcgttgggcatgggtttgacggcagccggggacgcgagggacacggcggacgcggtggcggctgagggcgcctactacctggaacaggtcaccataactgaagcatctgaagatgactatgaatatgaagagataccagatgacaattttagcatcccagaaggtgaagaagatctggcaaaagcaattcagatggcccaagaacaggctacagatactgaaattttggaacggaaaacagttcttccttcaaagcatgcagtacctgaagtaatagaagactttctctgcaatttcttgatcaaaatgggaatgaccagaactcttgattgctttcagtctgaatggtatgagttaatacagaaaggagtgactgaacttagaactgttgggaatgttccagatgtctacacccagattatgcttttggaaaatgagaacaaaaatttaaagaaagatttgaagcactacaaacaagcagctgagtatgttattttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PERP, TP53 apoptosis effector
- SAPS domain family, member 3
- Josephin domain containing 1
- integral membrane protein 2C

Buy SPAG16-sperm associated antigen 16 Gene now

Add to cart