Login to display prices
Login to display prices
C6orf108-chromosome 6 open reading frame 108 Gene View larger

C6orf108-chromosome 6 open reading frame 108 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C6orf108-chromosome 6 open reading frame 108 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C6orf108-chromosome 6 open reading frame 108 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011683
Product type: DNA & cDNA
Ncbi symbol: C6orf108
Origin species: Human
Product name: C6orf108-chromosome 6 open reading frame 108 Gene
Size: 2ug
Accessions: BC011683
Gene id: 10591
Gene description: chromosome 6 open reading frame 108
Synonyms: C6orf108; RCL; dJ330M21.3; 2'-deoxynucleoside 5'-phosphate N-hydrolase 1; c-Myc-responsive protein RCL; deoxyribonucleoside 5'-monophosphate N-glycosidase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgctgccatggtgccggggcgcagcgagagctgggagcgcggggagcctggccgcccggccctgtacttctgcgggagcattcgcggcggacgcgaggacaggacgctgtacgagcggatcgtgtctcggctgcggcgattcgggacagtgctcaccgagcacgtggcggccgccgagctgggcgcgcgcggggaagaggctgctgggggtgacaggctcatccatgagcaggacctggagtggctgcagcaggcggacgtggtcgtggcagaagtgacacagccatccttgggtgtaggctatgagctgggccgggccgtggcctttaacaagcggatcctgtgcctgttccgcccgcagtctggccgcgtgctttcggccatgatccggggagcagcagatggctctcggttccaggtgtgggactatgaggagggagaggtggaggccctgctggatcgatacttcgaggctgatcctccagggcaggtggctgcctcccctgacccaaccacttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 159
- solute carrier family 25, member 26
- chromosome 20 open reading frame 26
- chromosome 19 open reading frame 60