Login to display prices
Login to display prices
SLC25A26-solute carrier family 25, member 26 Gene View larger

SLC25A26-solute carrier family 25, member 26 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A26-solute carrier family 25, member 26 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A26-solute carrier family 25, member 26 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012852
Product type: DNA & cDNA
Ncbi symbol: SLC25A26
Origin species: Human
Product name: SLC25A26-solute carrier family 25, member 26 Gene
Size: 2ug
Accessions: BC012852
Gene id: 115286
Gene description: solute carrier family 25, member 26
Synonyms: COXPD28; SAMC; S-adenosylmethionine mitochondrial carrier protein; mitochondrial S-adenosylmethionine transporter; solute carrier family 25 (S-adenosylmethionine carrier), member 26; solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 26; solute carrier family 25 member 26
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaacatatgttggctgcctctgctggagaagtggttgcctgcctgattcgagttccatctgaagtggttaagcagagggcacaggtatctgcttctacaagaacatttcagattttctctaacatcttatatgaagagggtatccaagggttgtatcgaggctataaaagcacagttttaagagagattcctttttctttggtccagtttcccttatgggagtccttaaaagccctctggtcctggaggcaggatcatgtggtggattcttggcagtcagcagtctgtggagcttttgcaggtggatttgccgctgcagtcaccacccctctagacgtggcaaagacaagaattacgctggcaaaggctggctccagcactgctgatgggaatgtgctctctgtcctgcatggggtctggcggtcacaggggctggcaggattatttgcaggtgtcttccctcgaatggcagccatcagtctgggaggtttcatctttctgggggcttatgaccgaacgcacagcttgctgttggaagttggcagaaagagtccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 20 open reading frame 26
- chromosome 19 open reading frame 60
- transmembrane 4 L six family member 1
- zinc finger, CCHC domain containing 4