C20orf26-chromosome 20 open reading frame 26 Gene View larger

C20orf26-chromosome 20 open reading frame 26 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf26-chromosome 20 open reading frame 26 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf26-chromosome 20 open reading frame 26 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031674
Product type: DNA & cDNA
Ncbi symbol: C20orf26
Origin species: Human
Product name: C20orf26-chromosome 20 open reading frame 26 Gene
Size: 2ug
Accessions: BC031674
Gene id: 26074
Gene description: chromosome 20 open reading frame 26
Synonyms: C20orf26; CaM-IP3; dJ1002M8.3; dJ1178H5.4; cilia- and flagella-associated protein 61; cilia and flagella associated protein 61
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagttatgctttaagccatacaaacagaaaactaacattggaacctaaaattactgtcaatgccaagatcattgtggttggtgcatccagtgttggaatttccttcctagagacattggtattttgctctcacatgaagtttaataatcttaccctgatttcaactcatggactcccaggaaaaaaacttctggacactgaacaaaggaaatttttagccagcgaccactgttttaatgataaagattatgcactgatgtcactgtgctcctgggttaatgtcgtggtgggtagaatgaccggcatagaccgagcagccaagcacgttgtgctttccacggacgagatcgtgccctacgaccacctcatcctctgcaccgggcagcagtaccaggtcccatgccctacagaggctgatattagtcaacacctgacaaacagggaggttcccaacagcagtcagcggcggtacacggggaaagttccttgcaaccatttcactctcaacgaggaagaggattgctttaaggcactgatttggataaggaataactccatcaccacagaagatggaggaagagcatcagtgttattctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 19 open reading frame 60
- transmembrane 4 L six family member 1
- zinc finger, CCHC domain containing 4
- O-6-methylguanine-DNA methyltransferase

Buy C20orf26-chromosome 20 open reading frame 26 Gene now

Add to cart