Login to display prices
Login to display prices
C20orf26-chromosome 20 open reading frame 26 Gene View larger

C20orf26-chromosome 20 open reading frame 26 Gene

PTXBC031674

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf26-chromosome 20 open reading frame 26 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf26-chromosome 20 open reading frame 26 Gene

Proteogenix catalog: PTXBC031674
Ncbi symbol: C20orf26
Product name: C20orf26-chromosome 20 open reading frame 26 Gene
Size: 2ug
Accessions: BC031674
Gene id: 26074
Gene description: chromosome 20 open reading frame 26
Synonyms: C20orf26; CaM-IP3; dJ1002M8.3; dJ1178H5.4; cilia- and flagella-associated protein 61; cilia and flagella associated protein 61
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagttatgctttaagccatacaaacagaaaactaacattggaacctaaaattactgtcaatgccaagatcattgtggttggtgcatccagtgttggaatttccttcctagagacattggtattttgctctcacatgaagtttaataatcttaccctgatttcaactcatggactcccaggaaaaaaacttctggacactgaacaaaggaaatttttagccagcgaccactgttttaatgataaagattatgcactgatgtcactgtgctcctgggttaatgtcgtggtgggtagaatgaccggcatagaccgagcagccaagcacgttgtgctttccacggacgagatcgtgccctacgaccacctcatcctctgcaccgggcagcagtaccaggtcccatgccctacagaggctgatattagtcaacacctgacaaacagggaggttcccaacagcagtcagcggcggtacacggggaaagttccttgcaaccatttcactctcaacgaggaagaggattgctttaaggcactgatttggataaggaataactccatcaccacagaagatggaggaagagcatcagtgttattctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: