ZCCHC4-zinc finger, CCHC domain containing 4 Gene View larger

ZCCHC4-zinc finger, CCHC domain containing 4 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZCCHC4-zinc finger, CCHC domain containing 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZCCHC4-zinc finger, CCHC domain containing 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016914
Product type: DNA & cDNA
Ncbi symbol: ZCCHC4
Origin species: Human
Product name: ZCCHC4-zinc finger, CCHC domain containing 4 Gene
Size: 2ug
Accessions: BC016914
Gene id: 29063
Gene description: zinc finger, CCHC domain containing 4
Synonyms: HSPC052; ZGRF4; zinc finger CCHC domain-containing protein 4; DHHC domain-containing zinc finger protein; zinc finger, CCHC domain containing 4; zinc finger, GRF-type containing 4; zinc finger CCHC-type containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggtggtgcttcctttggatcctgccgtccccgccccgctgtgccctcacggacccactcttctgtttgtaaaggtgacccaagggaaagaagaaactcggaggttttatgcctgttcagcctgtagagatagaaaagactgtaatttttttcagtgggaagatgaaaagttgtcaggagctagacttgctgcccgagaagctcataaccgaagatgtcagcctcccctgtcccgaacgcagtgtgtggaaaggtacttgaagtttattgagttgcccttgactcagagaaagttttgtcaaacatgtcagcagttgttgttaccagatgactgggggcaacatagtgagcatcaggttctgggtaatgtgtccattacccagttaagaaggcccagtcaactcctttatccactggaaaacaagaagacaaatgcccagtatctgtttgctgatcggagctgtcagttcttggtagacttactttctgccctcggattcagaagagtactgtgtgttggaacaccaaggttgcatgagctgatcaagttgacagcatcaggtgacaagaagtctaacattaaaagccttttattggatattgattttcggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - O-6-methylguanine-DNA methyltransferase
- nicotinamide nucleotide transhydrogenase
- chromosome 10 open reading frame 10
- chromosome 10 open reading frame 58

Buy ZCCHC4-zinc finger, CCHC domain containing 4 Gene now

Add to cart