Login to display prices
Login to display prices
C10orf10-chromosome 10 open reading frame 10 Gene View larger

C10orf10-chromosome 10 open reading frame 10 Gene

PTXBC011402

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf10-chromosome 10 open reading frame 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf10-chromosome 10 open reading frame 10 Gene

Proteogenix catalog: PTXBC011402
Ncbi symbol: C10orf10
Product name: C10orf10-chromosome 10 open reading frame 10 Gene
Size: 2ug
Accessions: BC011402
Gene id: 11067
Gene description: chromosome 10 open reading frame 10
Synonyms: DEPP; FIG; Fseg; protein DEPP; decidual protein induced by progesterone; fasting induced; fasting-induced gene protein; fasting-induced protein; fat-specific expressed; chromosome 10 open reading frame 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggtcccggcttctgctctccgtggcccatctgcccacaattcgggagaccacggaggagatgctgcttgggggtcctggacaggagcccccaccctctcctagcctggatgactacgtgaggtctatatctcgactggcacagcccacctctgtgctagacaaggccacggcccagggccaacccaggccaccccacaggccagcccaggcctgccggaagggccgccctgctgtgtccctgcgagacatcaccgcacgtttcagtggccagcagcccacactgcccatggctgatactgtggaccccctggactggctttttggggagtcccaggaaaagcagccaagccagagggacctgccaaggaggactggcccctctgctggcctctggggtccacatagacagatggacagcagcaagcccatgggggcccccagagggaggctctgtgaagccaggatgcctgggcattccctggcaagaccaccgcaggatgggcagcagagctctgacctaagaagctggacttttgggcagtctgcccaagccatggcctcccgccaccgcccccgccccagcagtgtcctcagaacactctactcgcacctcccggtgatccatgaactctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: