C17orf66-chromosome 17 open reading frame 66 Gene View larger

C17orf66-chromosome 17 open reading frame 66 Gene

PTXBC033734

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C17orf66-chromosome 17 open reading frame 66 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C17orf66-chromosome 17 open reading frame 66 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033734
Product type: DNA & cDNA
Ncbi symbol: C17orf66
Origin species: Human
Product name: C17orf66-chromosome 17 open reading frame 66 Gene
Size: 2ug
Accessions: BC033734
Gene id: 256957
Gene description: chromosome 17 open reading frame 66
Synonyms: C17orf66; protein HEATR9; HEAT repeat-containing protein 9; HEAT repeat containing 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctatgaaaaatcaactgatatctctgatgtctccaggtcaatgttcctgtacccatggctggaatatccagacaagaccaaagaactcagaaaagccatggctcctgttcatctgcccttgtcctgctaccagatgccaaaggaagagtttcccccaagtccagagtgctggaggcagcatccgagcaagccaaactcagtcccgtactgctacttcaagaaacctgagatctacacgcactggcacgacctgtatgatcagcgagaggaaagggaggctgagaagatgttgaggaaaatgagagatgactgtaggtacatcaaagaggtacatcaaacccacatcaaaatgttccatctcccaatgagcaagctgactataaaatctgagatgcgatccaggcccttagagcctacccaggaccccctgaagtggcaaagattaagggaactcacaaaaagcctggaatctcccagagaggatgagcagttctatgcagcacaggctctgggatgcttacgcatcagtgacaagtttgtcatggaggcactacagcaggtggtgagtctgagaactgctggagttcaggaaagaaggaaacagggtctgagatgtgtggcatgtgggcacagacgaggctccccggggtgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 12 open reading frame 10
- chromosome 10 open reading frame 62
- glutathione S-transferase mu 3 (brain)
- zinc finger, MYND-type containing 19

Buy C17orf66-chromosome 17 open reading frame 66 Gene now

Add to cart