ZMYND19-zinc finger, MYND-type containing 19 Gene View larger

ZMYND19-zinc finger, MYND-type containing 19 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZMYND19-zinc finger, MYND-type containing 19 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZMYND19-zinc finger, MYND-type containing 19 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012948
Product type: DNA & cDNA
Ncbi symbol: ZMYND19
Origin species: Human
Product name: ZMYND19-zinc finger, MYND-type containing 19 Gene
Size: 2ug
Accessions: BC012948
Gene id: 116225
Gene description: zinc finger, MYND-type containing 19
Synonyms: MIZIP; zinc finger MYND domain-containing protein 19; MCH-R1-interacting zinc finger protein; melanin-concentrating hormone receptor 1 interacting zinc-finger protein; zinc finger, MYND domain containing 19; zinc finger MYND-type containing 19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccgacttcaaattgggtatcgtgcggctcggccgggtggccgggaagaccaaatacacgctgatcgatgagcaggacatcccgctggtggagagctactcctttgaggcccgaatggaagtggatgcagatggaaatggtgctaagatatttgcctatgcctttgacaagaaccgaggaaggggctctgggagactccttcatgagctgctgtgggagcggcaccgggggggcgtggccccgggcttccaggtggtgcacctcaacgctgtgaccgtggacaatcgcctggacaacctgcaactggtgccgtggggctggcggcccaaggctgaagagacctccagcaagcagagggagcaaagcttgtattggcttgcaattcagcagctgcctacagaccctatagaagaacagtttcctgtcctaaatgtgacccggtattataatgccaacggggatgtagtggaagaggaggagaactcttgcacctactatgagtgccactaccctccctgcacagtgattgagaagcagctccgggagttcaacatctgtgggcgctgccaggtggcccggtactgcggctcccagtgccagcagaaggactggcctgcccacaagaagcactgtcgggagaggaagcgtcccttccagcatgagcttgagccagagcgatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dephospho-CoA kinase domain containing
- chromosome 17 open reading frame 70
- chromosome 12 open reading frame 32
- chromosome 1 open reading frame 190

Buy ZMYND19-zinc finger, MYND-type containing 19 Gene now

Add to cart