GSTM3-glutathione S-transferase mu 3 (brain) Gene View larger

GSTM3-glutathione S-transferase mu 3 (brain) Gene

PTXBC008790

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GSTM3-glutathione S-transferase mu 3 (brain) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GSTM3-glutathione S-transferase mu 3 (brain) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008790
Product type: DNA & cDNA
Ncbi symbol: GSTM3
Origin species: Human
Product name: GSTM3-glutathione S-transferase mu 3 (brain) Gene
Size: 2ug
Accessions: BC008790
Gene id: 2947
Gene description: glutathione S-transferase mu 3 (brain)
Synonyms: GSTM3-3; GST5; GSTB; GTM3; glutathione S-transferase Mu 3; GST class-mu 3; S-(hydroxyalkyl)glutathione lyase M3; brain GST; brain type mu-glutathione S-transferase; glutathione S-alkyltransferase M3; glutathione S-aralkyltransferase M3; glutathione S-aryltransferase M3; glutathione S-transferase M3 (brain); glutathione S-transferase mu 3 (brain); glutathione S-transferase, Mu-3; hGSTM3-3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgtgcgagtcgtctatggttctcgggtactgggatattcgtgggctggcgcacgccatccgcctgctcctggagttcacggatacctcttatgaggagaaacggtacacgtgcggggaagctcctgactatgatcgaagccaatggctggatgtgaaattcaagctagacctggactttcctaatctgccctacctcctggatgggaagaacaagatcacccagagcaatgccatcttgcgctacatcgctcgcaagcacaacatgtgtggtgagactgaagaagaaaagattcgagtggacatcatagagaaccaagtaatggatttccgcacacaactgataaggctctgttacagctctgaccacgaaaaactgaagcctcagtacttggaagagctacctggacaactgaaacaattctccatgtttctggggaaattctcatggtttgccggggaaaagctcacctttgtggattttctcacctatgatatcttggatcagaaccgtatatttgaccccaagtgcctggatgagttcccaaacctgaaggctttcatgtgccgttttgaggctttggagaaaatcgctgcctacttacagtctgatcagttctgcaagatgcccatcaacaacaagatggcccagtggggcaacaagcctatatgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, MYND-type containing 19
- dephospho-CoA kinase domain containing
- chromosome 17 open reading frame 70
- chromosome 12 open reading frame 32

Buy GSTM3-glutathione S-transferase mu 3 (brain) Gene now

Add to cart