C10orf62-chromosome 10 open reading frame 62 Gene View larger

C10orf62-chromosome 10 open reading frame 62 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf62-chromosome 10 open reading frame 62 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf62-chromosome 10 open reading frame 62 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC037252
Product type: DNA & cDNA
Ncbi symbol: C10orf62
Origin species: Human
Product name: C10orf62-chromosome 10 open reading frame 62 Gene
Size: 2ug
Accessions: BC037252
Gene id: 414157
Gene description: chromosome 10 open reading frame 62
Synonyms: uncharacterized protein C10orf62; bA548K23.1; chromosome 10 open reading frame 62
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgtgggttcagagaaagaggagaagaaaggaaacctctgagtgtccatcagacaaggacaagtcaccagaatcccataaagcaaagaatgaaagctggattaaatcccactttagccgcctttccgaagagaagctggccctcgacaacaatgccagcgctagtggcaatgctacccagactgagagtgggagtgaagaggtcagctccacggttcacatagagaccttcaccacgaggcacggagaagtgggctccgctctgcaccgggaatccttcaccagcaggcagaagacatctgggccctcagtgatccaagagatccaccaggagtctggaaaagccccatccactgatgacgccacgtgggccgctgtggctgcctgcaccaaggagattgacacccaggggcggcacctggctcactccatgctgcagcgggccatagcttaccagcactcaggtcacctggagtccaaggacatcaaccaggaggagctgagggccctcgaggaggtagagatgaagctgcaaaagaatttcctcacccagcgggaaaacaccatagctggtgccaatcacacacacaccttctatggccacagtcaccacagtcaccatggccacccaagccaccagagccacagcctgcctaatcgcagacactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutathione S-transferase mu 3 (brain)
- zinc finger, MYND-type containing 19
- dephospho-CoA kinase domain containing
- chromosome 17 open reading frame 70

Buy C10orf62-chromosome 10 open reading frame 62 Gene now

Add to cart