C12orf10-chromosome 12 open reading frame 10 Gene View larger

C12orf10-chromosome 12 open reading frame 10 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C12orf10-chromosome 12 open reading frame 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C12orf10-chromosome 12 open reading frame 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028904
Product type: DNA & cDNA
Ncbi symbol: C12orf10
Origin species: Human
Product name: C12orf10-chromosome 12 open reading frame 10 Gene
Size: 2ug
Accessions: BC028904
Gene id: 60314
Gene description: chromosome 12 open reading frame 10
Synonyms: Gamm1; MST024; MSTP024; MYG; MYG1; UPF0160 protein MYG1, mitochondrial; melanocyte proliferating gene 1; melanocyte related; chromosome 12 open reading frame 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgggcaccctctatgacaagatgtatgagaactttgtggaggaggtggatgctgtggacaatgggatctcccagtgggcagagggggagcctcgatatgcactgaccactaccctgagtgcacgagttgctcgacttaatcctacctggaaccaccccgaccaagacactgaggcagggttcaagcgtgcaatggatctggttcaagaggagtttctgcagagattagatttctaccaacacagctggctgccagcccgggccttggtggaagaggcccttgcccagcgattccaggtggacccaagtggagagattgtggaactggcgaaaggtgcatgtccctggaaggagcatctctaccacctggaatctgggctgtcccctccagtggccatcttctttgttatctacactgaccaggctggacagtggcgaatacagtgtgtgcccaaggagccccactcattccaaagccggctgcccctgccagagccatggcggggtcttcgggacgaggccctggaccaggtcagtgggatccctggctgcatcttcgtccatgcaagcggcttcattggcggtcaccgcacccgagagggtgccttgagcatggcccgtgccaccttggcccagcgctcatacctcccacaaatctcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 10 open reading frame 62
- glutathione S-transferase mu 3 (brain)
- zinc finger, MYND-type containing 19
- dephospho-CoA kinase domain containing

Buy C12orf10-chromosome 12 open reading frame 10 Gene now

Add to cart