C10orf58-chromosome 10 open reading frame 58 Gene View larger

C10orf58-chromosome 10 open reading frame 58 Gene

PTXBC005871

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf58-chromosome 10 open reading frame 58 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf58-chromosome 10 open reading frame 58 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005871
Product type: DNA & cDNA
Ncbi symbol: C10orf58
Origin species: Human
Product name: C10orf58-chromosome 10 open reading frame 58 Gene
Size: 2ug
Accessions: BC005871
Gene id: 84293
Gene description: chromosome 10 open reading frame 58
Synonyms: UPF0765 protein C10orf58; C10orf58; PAMM; redox-regulatory protein FAM213A; peroxiredoxin (PRX)-like 2 activated in M-CSF stimulated monocytes; peroxiredoxin-like 2 activated in M-CSF stimulated monocytes; redox-regulatory protein PAMM; family with sequence similarity 213 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggatgtggtccattggtgcaggagccctgggggctgctgccttggcattgctgcttgccaacacagacgtgtttctgtccaagccccagaaagcggccctggagtacctggaggatatagacctgaaaacactggagaaggaaccaaggactttcaaagcaaaggagctatgggaaaaaaatggagctgtgattatggccgtgcggaggccaggctgtttcctctgtcgagaggaagctgcggatctgtcctccctgaaaagcatgttggaccagctgggcgtccccctctatgcagtggtaaaggagcacatcaggactgaagtgaaggatttccagccttatttcaaaggagaaatcttcctggatgaaaagaaaaagttctatggtccacaaaggcggaagatgatgtttatgggatttatccgtctgggagtgtggtacaacttcttccgagcctggaacggaggcttctctggaaacctggaaggagaaggcttcatccttgggggagttttcgtggtgggatcaggaaagcagggcattcttcttgagcaccgagaaaaagaatttggagacaaagtaaacctactttctgttctggaagctgctaagatgatcaaaccacagactttggcctcagagaaaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 17 open reading frame 66
- chromosome 12 open reading frame 10
- chromosome 10 open reading frame 62
- glutathione S-transferase mu 3 (brain)

Buy C10orf58-chromosome 10 open reading frame 58 Gene now

Add to cart