MGMT-O-6-methylguanine-DNA methyltransferase Gene View larger

MGMT-O-6-methylguanine-DNA methyltransferase Gene

PTXBC000824

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGMT-O-6-methylguanine-DNA methyltransferase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGMT-O-6-methylguanine-DNA methyltransferase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000824
Product type: DNA & cDNA
Ncbi symbol: MGMT
Origin species: Human
Product name: MGMT-O-6-methylguanine-DNA methyltransferase Gene
Size: 2ug
Accessions: BC000824
Gene id: 4255
Gene description: O-6-methylguanine-DNA methyltransferase
Synonyms: methylated-DNA--protein-cysteine methyltransferase; 6-O-methylguanine-DNA methyltransferase; O-6-methylguanine-DNA-alkyltransferase; O6-methylguanine-DNA methyltransferase; methylguanine-DNA methyltransferase; O-6-methylguanine-DNA methyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacaaggattgtgaaatgaaacgcaccacactggacagccctttggggaagctggagctgtctggttgtgagcagggtctgcacgaaataaagctcctgggcaaggggacgtctgcagctgatgccgtggaggtcccagcccccgctgcggttctcggaggtccggagcccctgatgcagtgcacagcctggctgaatgcctatttccaccagcccgaggctatcgaagagttccccgtgccggctcttcaccatcccgttttccagcaagagtcgttcaccagacaggtgttatggaagctgctgaaggttgtgaaattcggagaagtgatttcttaccagcaattagcagccctggcaggcaaccccaaagccgcgcgagcagtgggaggagcaatgagaggcaatcctgtccccatcctcatcccgtgccacagagtggtctgcagcagcggagccgtgggcaactactccggaggactggccgtgaaggaatggcttctggcccatgaaggccaccggttggggaagccaggcttgggagggagctcaggtctggcaggggcctggctcaagggagcgggagctacctcgggctccccgcctgctggccgaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nicotinamide nucleotide transhydrogenase
- chromosome 10 open reading frame 10
- chromosome 10 open reading frame 58
- chromosome 17 open reading frame 66

Buy MGMT-O-6-methylguanine-DNA methyltransferase Gene now

Add to cart