C19orf60-chromosome 19 open reading frame 60 Gene View larger

C19orf60-chromosome 19 open reading frame 60 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf60-chromosome 19 open reading frame 60 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf60-chromosome 19 open reading frame 60 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012078
Product type: DNA & cDNA
Ncbi symbol: C19orf60
Origin species: Human
Product name: C19orf60-chromosome 19 open reading frame 60 Gene
Size: 2ug
Accessions: BC012078
Gene id: 55049
Gene description: chromosome 19 open reading frame 60
Synonyms: uncharacterized protein C19orf60; chromosome 19 open reading frame 60
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatcaccgagaccgcggcggagcctacggtccctgcagtgcctgctgctgaggaggccaccgaagctcggggacgcgaggagccggcgtggccctggaaagacgccccgatccggacgctggtgcagcgcatccaccagctgcaggctgagcgcgcgcagggcttccgccgactggaggagtggttggcgccggtgcagggcctgagagcctgggggcgcggcctcagggtccccacatgccgcagaggccaccgccagtacctgcgcagcggccctgactacgacttcgcgcgctaccggagcacagtgcacggggtgacccaggccttcgccgccgcctcgcgggaggtgctggcggtggaagcagagctgggcgggcctcgcaggcagccgctgctcgccggccacgtgcgcagcctgcaggagctggagcagacgcggctgggcacggtggccctgctgcagttgatggagacgccagagctggcggggcaggaggacgctgtacggatgcagcagctgaaaatgaaggtaattaaaaccatggaggcgatcagcgaggttctccaggaccttaggtttgatgcggaatctgccgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane 4 L six family member 1
- zinc finger, CCHC domain containing 4
- O-6-methylguanine-DNA methyltransferase
- nicotinamide nucleotide transhydrogenase

Buy C19orf60-chromosome 19 open reading frame 60 Gene now

Add to cart