Login to display prices
Login to display prices
C1orf159-chromosome 1 open reading frame 159 Gene View larger

C1orf159-chromosome 1 open reading frame 159 Gene

PTXBC008788

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf159-chromosome 1 open reading frame 159 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf159-chromosome 1 open reading frame 159 Gene

Proteogenix catalog: PTXBC008788
Ncbi symbol: C1orf159
Product name: C1orf159-chromosome 1 open reading frame 159 Gene
Size: 2ug
Accessions: BC008788
Gene id: 54991
Gene description: chromosome 1 open reading frame 159
Synonyms: uncharacterized protein C1orf159 homolog; RIKEN cDNA 9430015G10 gene
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctgcggcacctcgccctcctggctggccttctcgtgggagtcgccagcaagtccatggagaacacggcccagctgcccgagtgctgtgtggatgtggtgggcgtcaacgccagctgcccaggcgcaagtctgtgtggtccaggctgttacaggcgctggaacgcggacgggagcgccagctgcgtccgctgtgggaacggaaccctcccagcctacaacggctccgagtgtagaagctttgctggcccgggtgcgccattccccatgaacagaagctcagggacccccgggcggccacatcctggggctccgcgcgtggccgcctccctcttcctgggcacgttcttcatcagctccggcctcatcctctccgtagctgggttcttctacctcaagcgctccagtaaactccccagggcctgctacagaagaaacaaagggccggcccccgcagggtccctgccaggcagatggtccagccagcagttcggaccccaagctccggccctgcagcctggcgaagccgtaagtaacccacatcatccgggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice