Login to display prices
Login to display prices
C19orf10-chromosome 19 open reading frame 10 Gene View larger

C19orf10-chromosome 19 open reading frame 10 Gene

PTXBC010129

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf10-chromosome 19 open reading frame 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf10-chromosome 19 open reading frame 10 Gene

Proteogenix catalog: PTXBC010129
Ncbi symbol: C19orf10
Product name: C19orf10-chromosome 19 open reading frame 10 Gene
Size: 2ug
Accessions: BC010129
Gene id: 56005
Gene description: chromosome 19 open reading frame 10
Synonyms: UPF0556 protein C19orf10; C19orf10; EUROIMAGE1875335; IL25; IL27; IL27w; R33729_1; myeloid-derived growth factor; interleukin 27 working designation; interleukin-25; stromal cell-derived growth factor SF20; myeloid derived growth factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgcccagcggagggtggaacggcgtcggcgcgagcttgtgggccgcgctgctcctaggggccgtggcgctgaggccggcggaggcggtgtccgagcccacgacggtggcgtttgacgtgcggcccggcggcgtcgtgcattccttctcccataacgtgggcccgggggacaaatatacgtgtatgttcacttacgcctctcaaggagggaccaatgagcaatggcagatgagtctggggaccagcgaagaccaccagcacttcacctgcaccatctggaggccccaggggaagtcctatctgtacttcacacagttcaaggcagaggtgcggggcgctgagattgagtacgccatggcctactctaaagccgcatttgaaagggaaagtgatgtccctctgaaaactgaggaatttgaagtgaccaaaacagcagtggctcacaggcccggggcattcaaagctgagctgtccaagctggtgattgtggccaaggcatcgcgcactgagctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice