GCSH-glycine cleavage system protein H (aminomethyl carrier) Gene View larger

GCSH-glycine cleavage system protein H (aminomethyl carrier) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GCSH-glycine cleavage system protein H (aminomethyl carrier) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GCSH-glycine cleavage system protein H (aminomethyl carrier) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000790
Product type: DNA & cDNA
Ncbi symbol: GCSH
Origin species: Human
Product name: GCSH-glycine cleavage system protein H (aminomethyl carrier) Gene
Size: 2ug
Accessions: BC000790
Gene id: 2653
Gene description: glycine cleavage system protein H (aminomethyl carrier)
Synonyms: GCE; NKH; glycine cleavage system H protein, mitochondrial; glycine cleavage system protein H (aminomethyl carrier); lipoic acid-containing protein; mitochondrial glycine cleavage system H-protein; glycine cleavage system protein H
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctgcgagtggtgcggagcgtgcgggccctgctctgcaccctgcgcgcggtcccgttacccgccgcgccctgcccgccgaggccctggcagctgggggtgggcgccgtccgtacgctgcgcactggacccgctctgctctcggtgcgtaaattcacagagaaacacgaatgggtaacaacagaaaatggcattggaacagtgggaatcagcaattttgcacaggaagcgttgggagatgttgtttattgtagtctccctgaagttgggacaaaattgaacaaacaagatgagtttggtgctttggaaagtgtgaaagctgctagtgaactctattctcctttatcaggagaagtaactgaaattaatgaagctcttgcagaaaatccaggacttgtaaacaaatcttgttatgaagatggttggctgatcaagatgacactgagtaacccttcagaactagatgaacttatgagtgaagaagcatatgagaaatacataaaatctattgaggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast)
- ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)
- Parkinson disease (autosomal recessive, early onset) 7
- killer cell lectin-like receptor subfamily G, member 1

Buy GCSH-glycine cleavage system protein H (aminomethyl carrier) Gene now

Add to cart