Login to display prices
Login to display prices
SNX12-sorting nexin 12 Gene View larger

SNX12-sorting nexin 12 Gene

PTXBC020559

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNX12-sorting nexin 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNX12-sorting nexin 12 Gene

Proteogenix catalog: PTXBC020559
Ncbi symbol: SNX12
Product name: SNX12-sorting nexin 12 Gene
Size: 2ug
Accessions: BC020559
Gene id: 29934
Gene description: sorting nexin 12
Synonyms: sorting nexin-12; sorting nexin 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggacacggcagtagctgatacccggcgccttaactcgaagccgcaggacctgaccgacgcttacgggccgccaagtaacttcctggagatcgacatctttaatcctcagacggtgggcgtgggacgcgcgcgcttcaccacctatgaggttcgcatgcggacaaacctacctatcttcaagctaaaggagtcctgcgtacggcggcgctacagtgactttgagtggctgaaaaatgagctggagagagatagcaagattgtagtaccaccactgcctgggaaagccttgaagcggcagctccctttccgaggagatgaagggatctttgaggagtctttcatcgaagaaaggaggcagggcctcgagcagtttattaacaaaattgctgggcacccactggctcagaatgaacgctgcctacacatgttcctgcaagaggaggcaattgacaggaactacgtcccggggaagagtcttgctgtgtcttgcccaggctggagtgcagtggcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice